Darwin Core OWL

Metadata

IRI: http://bioboum.ca/dwc-owl.owl
Title: Darwin Core OWL
Date Created: 2025-04-03
Version Info: 0.0.3
Preferred Namespace Prefix: dwcowl
Description: Darwin Core OWL is an effort to represent Darwin Core terms, along with the newly proposed Darwin Core DataPackage terms, as OWL concepts, specifically as OWL classes and properties. Darwin-SW has previously explored similar ideas using OWL classes. This work extends that approach by incorporating OWL restrictions and additional object properties. The goal is to interlink entities through these object properties, creating a semantically connected network of biodiversity data rather than a simple, flat RDF representation.

Classes

Permit Status Vocabulary ^c

IRI	`http://data.ggbn.org/schemas/ggbn/terms/permitStatus_vocabulary`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Vocabulary of ggbn:permitStatus.
Sub Class Of	Concept ^c
In Range Of	Has Permit Status ^op

Permit Type Vocabulary ^c

IRI	`http://data.ggbn.org/schemas/ggbn/terms/permitType_vocabulary`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Vocabulary of ggbn:permitType term.
Sub Class Of	Concept ^c
In Range Of	Has Permit Type ^op

Agent ^c

IRI	`http://purl.org/dc/terms/Agent`
Is Defined By	DCMI Metadata Terms
Description	A person, group, organization, machine, software or other entity that can act. Membership in the [dcterms:Agent] class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious. A resource that acts or has the power to act.
Example	Carl Linnaeus ChatGPT The El Yunque National Forest ARBIMON System The National Science Foundation The Terra Nova Expedition
In Domain Of	Agent ID ^dp Agent Remarks ^dp Agent Type ^dp Preferred Agent Name ^dp Asserted ^op Recorded (DWCDP) ^op
In Range Of	Asserted By ^op Authored By ^op Commented By ^op Conducted By ^op Created By ^op Edited By ^op Funded By ^op Georeferenced By ^op Identifications By ^op Identified By ^op Issued By ^op Metadata Creator (DWCDP) ^op Metadata Provider (DWCDP) ^op Owned By ^op Published By ^op Recorded By (DWCDP) ^op Reviewed By ^op Rights Held By ^op Sampling Performed By ^op Stored In ^op
Restriction	Preferred Agent Name ^dp max 1 Agent Type ^dp exactly 1

Bibliographic Resource ^c

IRI	`http://purl.org/dc/terms/BibliographicResource`
Is Defined By	DCMI Metadata Terms
Description	A book, article, or other documentary resource.
In Domain Of	Parent Reference ID ^dp Reference ID ^dp Reference Type ^dp Authored By ^op Edited By ^op Mentions ^op Used For ^op
In Range Of	Mentioned In ^op Used ^op
Restriction	Part Of ^op only Bibliographic Resource ^c Reference Type ^dp max 1
Super Class Of	Bibliographic Document ^c

Location ^c

IRI	`http://purl.org/dc/terms/Location`
Is Defined By	DCMI Metadata Terms
Description	A spatial region or named place.
Example	the municipality of San Carlos de Bariloche, Río Negro, Argentina the place defined by a georeference
In Domain Of	Continent ^dp Coordinate Precision ^dp Coordinate Uncertainty In Meters ^dp Country ^dp Country Code ^dp Decimal Latitude ^dp Decimal Longitude ^dp Footprint SRS ^dp Footprint WKT ^dp Geodetic Datum ^dp Georeference Protocol ^dp Georeference Remarks ^dp Georeference Sources ^dp Georeference Verification Status ^dp Georeferenced By ^dp Georeferenced Date ^dp Higher Geography ^dp Higher Geography ID ^dp Island ^dp Island Group ^dp Locality ^dp Location According To ^dp Location Remarks ^dp Maximum Depth In Meters ^dp Maximum Distance Above Surface In Meters ^dp Maximum Elevation In Meters ^dp Minimum Depth In Meters ^dp Minimum Distance Above Surface In Meters ^dp Minimum Elevation In Meters ^dp Third Order Division ^dp Point Radius Spatial Fit ^dp First Order Division ^dp Verbatim Coordinate System ^dp Verbatim Coordinates ^dp Verbatim Depth ^dp Verbatim Elevation ^dp Verbatim Latitude ^dp Verbatim Locality ^dp Verbatim Longitude ^dp Verbatim SRS ^dp Vertical Datum ^dp Water Body ^dp Georeferenced By ^op
In Range Of	Located At ^op Spatial Location ^op

Document (BIBO) ^c

IRI	`http://purl.org/ontology/bibo/Document`
Is Defined By	http://purl.org/ontology/bibo/
Description	A document (noun) is a bounded physical representation of body of information designed with the capacity (and usually intent) to communicate. A document may manifest symbolic, diagrammatic or sensory-representational information.
In Domain Of	Edition ^dp Issue ^dp Pages ^dp Status ^op Volume ^dp
Super Class Of	Bibliographic Document ^c

Document Status ^c

IRI	`http://purl.org/ontology/bibo/DocumentStatus`
Is Defined By	http://purl.org/ontology/bibo/
Description	The status of the publication of a document.
Example	Accepted Published
In Range Of	Status ^op

Media ^c

IRI	`http://rs.tdwg.org/ac/terms/Media`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	An instance of digital textual media may be better represented as a dcterms:BibliographicResource. A dcmi:MediaType or other media type with other entities as subject matter.
Example	dcmi:MovingImage dcmi:Sound dcmi:StillImage
In Domain Of	Original Date and Time ^dp Sample Rate ^dp Caption ^dp Capture Device ^dp Digitization Date ^dp End Time in Seconds ^dp End Time Stamp ^dp Frame Rate ^dp Upper Frequency Bound ^dp Lower Frequency Bound ^dp Hash Function ^dp Hash ^dp Fractional Height ^dp Is Part Of Media ID ^dp Media Duration ^dp Media Speed ^dp Radius ^dp Resource Creation Technique ^dp Start Time in Seconds ^dp Start Time Stamp ^dp Subject Orientation ^dp Subject Orientation Literal ^dp Subject Part ^dp Subject Part Literal ^dp Subtype Literal ^dp Time Of Day ^dp Fractional Width ^dp Fractional X ^dp Fractional Y ^dp Derived From Media ID ^dp Has Subject Orientation ^op Has Subject Part ^op Media ID ^dp Commented By ^op Media Of ^op Reviewed By ^op
In Range Of	Has Media ^op
Restriction	Fractional Height ^dp max 1 Fractional Width ^dp max 1 Time Of Day ^dp max 1 Derived From ^op only Media ^c Frame Rate ^dp max 1 Hash ^dp max 1 Capture Device ^dp max 1 Upper Frequency Bound ^dp max 1 Hash Function ^dp max 1 Resource Creation Technique ^dp max 1 Sample Rate ^dp max 1 Digitization Date ^dp max 1 Lower Frequency Bound ^dp max 1 Part Of ^op only Media ^c

Chronometric Age ^c

IRI	`http://rs.tdwg.org/chrono/terms/ChronometricAge`
Is Defined By	http://rs.tdwg.org/chrono/terms/
Description	The age of a [dwc:MaterialEntity] and how this age is known, whether by a dating assay, or a relative association with dated material, or legacy collection information. An approximation of temporal position (in the sense conveyed by [https://www.w3.org/TR/owl-time/#time:TemporalPosition]) that is supported by evidence.
Example	a maximum age associated with a specimen derived from K-Ar dating applied to a proximal volcanic tuff found stratigraphically below the specimen an age of a specimen based on what is reported in legacy collections data an age range associated with a specimen derived from a ceramics analysis based on other materials found in the same stratum an age range associated with a specimen derived from an AMS dating assay applied to an oyster shell in the same stratum an age range of a specimen based on its biostratigraphic content
In Domain Of	Dated Material ^op

Assertion ^c

IRI	`http://rs.tdwg.org/dwc/terms/Assertion`
Is Defined By	http://rs.tdwg.org/dwc/terms/
In Domain Of	Assertion Effective Date ^dp Assertion ID ^dp Assertion Made Date ^dp Assertion Type ^dp Assertion Type Source ^dp Assertion Value ^dp Assertion Value Numeric ^dp Assertion Value Source ^dp Verbatim Assertion Type ^dp About ^op Asserted By ^op
In Range Of	Asserted ^op
Super Class Of	Material Entity Assertion ^c Occurrence Assertion ^c Organism Assertion ^c

Bibliographic Document ^c

IRI	`http://rs.tdwg.org/dwc/terms/BibliographicDocument`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An owl:Class created as a subclass of both dcterms:BibliographicResource and bibo:Document to allow setting of restrictions. A book, article, or other documentatry resource.
Sub Class Of	Bibliographic Resource ^c Document (BIBO) ^c
Restriction	Pages ^dp max 1 Title (DC) ^dp exactly 1 Volume ^dp max 1 Status ^op max 1 Edition ^dp max 1 Issue ^dp max 1

Degree Of Establishment ^c

IRI	`http://rs.tdwg.org/dwc/terms/DegreeOfEstablishment`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	For details and rationale, see Groom et al. 2019. Controlled value for Darwin Core terms with local name degreeOfEstablishment.
Sub Class Of	Concept ^c

Establishment Means ^c

IRI	`http://rs.tdwg.org/dwc/terms/EstablishmentMeans`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	For details and rationale, see Groom et al. 2019. Controlled value for Darwin Core terms with local name establishmentMeans.
Sub Class Of	Concept ^c

Event ^c

IRI	`http://rs.tdwg.org/dwc/terms/Event`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An action, process, or set of circumstances occurring at a [dcterms:Location] during a period of time.
Example	a biotic survey a bird observation a camera trap image capture a material collecting event an organism occurrence
In Domain Of	Located At ^op Field Number (IRI) ^op Day ^dp End Day Of Year ^dp Event Category ^dp Event Date ^dp Event ID ^dp Event Remarks ^dp Event Time ^dp Event Type ^dp Field Notes ^dp Field Number ^dp Habitat ^dp Month ^dp Parent Event ID ^dp Preferred Event Name ^dp Sampling Effort ^dp Sampling Protocol ^dp Start Day Of Year ^dp Verbatim EventDate ^dp Year ^dp Conducted By ^op Spatial Location ^op
In Range Of	Collected During ^op Happened During ^op Material Collected During ^op
Restriction	Preferred Event Name ^dp max 1

Geological Context ^c

IRI	`http://rs.tdwg.org/dwc/terms/GeologicalContext`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A set of geological designations, such as stratigraphy, that qualifies a [dcterms:Location].
Example	a particular lithostratigraphic layer a specific chronostratigraphic unit
In Domain Of	Bed ^dp Earliest Age Or Lowest Stage ^dp Earliest Eon Or Lowest Eonothem ^dp Earliest Epoch Or Lowest Series ^dp Earliest Era Or Lowest Erathem ^dp Earliest Period Or Lowest System ^dp Formation ^dp Geological Context ID ^dp Group ^dp Highest Biostratigraphic Zone ^dp Latest Age Or Highest Stage ^dp Latest Eon Or Highest Eonothem ^dp Latest Epoch Or Highest Series ^dp Latest Era Or Highest Erathem ^dp Latest Period Or Highest System ^dp Lithostratigraphic Terms ^dp Lowest Biostratigraphic Zone ^dp Member ^dp
In Range Of	Happened Within ^op
Restriction	Geological Context ID ^dp exactly 1

Identification ^c

IRI	`http://rs.tdwg.org/dwc/terms/Identification`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	For biology, the assignment of a scientific name or taxon concept to a [dwc:Organism]. A classification of a resource according to a classification scheme.
Example	a nomenclatural act designating a specimen as a holotype a subspecies determination of an organism
In Domain Of	Identification ID ^dp Verbatim Identification ^dp Based On ^op Target Occurrence ^op To Taxon (DWCDP) ^op Type Designation Type ^op Used ^op
In Range Of	Taxon For ^op Used For ^op

Material Entity ^c

IRI	`http://rs.tdwg.org/dwc/terms/MaterialEntity`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. An entity that can be identified, exist for some period of time, and consist in whole or in part of physical matter while it exists.
Example	a flower on a plant specimen a fossil within a rock a rock containing fossils a specific water sample a subset of the contents of a trawl an herbarium sheet with its attached plant specimen an isolated molecule of DNA the body of a fish the entire contents of a trawl the stomach contents of a fish
In Domain Of	Disposition ^dp Material Entity ID ^dp Object Quantity ^dp Object Quantity Type ^dp Owner Institution Code ^dp Preparations ^dp Verbatim Label ^dp Analyzed In ^op Collected During ^op Owned By ^op Stored In ^op Geo Classification Code ^dp Geo Name ^dp
In Range Of	Analysis Of ^op Dated Material ^op
Restriction	Derived From ^op only Material Entity ^c Part Of ^op only Material Entity ^c

Material Entity Assertion ^c

IRI	`http://rs.tdwg.org/dwc/terms/MaterialEntityAssertion`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A [dwc:Assertion] made by a [dcterms:Agent] about a [dwc:MaterialEntity].
Sub Class Of	Assertion ^c
In Domain Of	Aggregate Form ^dp Alteration Description ^dp Associated Minerals ^dp Cleavage ^dp Color ^dp Crystal Form ^dp Crystal Habit ^dp Exsolution Texture ^dp Inclusions ^dp Luminescence ^dp Luster ^dp Maximum Crystal Dimension In Millimiters ^dp Maximum Specimen Dimension In Millimeters ^dp Measured Mass In Grams ^dp Mineral Description ^dp Specimen Description ^dp Twinning Law ^dp Verbatim Mass ^dp Verbatim Size ^dp
Restriction	About ^op some Material Entity ^c

Molecular Protocol ^c

IRI	`http://rs.tdwg.org/dwc/terms/MolecularProtocol`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A [dwc:Protocol] used to derive and identify a [dwc:NucleotideSequence] from a [dwc:MaterialEntity].
Sub Class Of	Protocol ^c
Equivalentclass	Followed By ^op some Nucleotide Analysis ^c
In Domain Of	DNA Concentration ^dp DNA Concentration Unit ^dp Method For Concentration Measurement ^dp Ratio Of Absorbance At 260 nm and 230 nm ^dp Ratio Of Absorbance At 260 nm and 280 nm ^dp DNA Sequence ^dp Amplicon Size ^dp Annealing Phase Temperature ^dp Annealing Phase Temperature Unit ^dp Fluorescence Baseline Value ^dp Probe Quencher ^dp Probe Reporter ^dp Quantification Cycle Number ^dp Fluorescence Cycle Threshold ^dp Forward PCR Primer ^dp Forward PCR Primer Name ^dp Reverse PCR Primer Name ^dp PCR Primer Reference ^dp Reverse PCR Primer ^dp Assay Type ^dp Molecular Protocol ID ^dp Amount Or Size Of Sample Collected ^dp Sample Collection Device ^dp Isolation And Growth Condition ^dp Contamination Screening Input ^dp WGA Amplification Kit ^dp Experimental Factor ^dp Broad-scale Environmental Context ^dp Local Environmental Context ^dp Environmental Medium ^dp Relation To Oxygen ^dp Sample Material Processing ^dp Size Fraction Selected ^dp Subspecific Genetic Lineage ^dp Ploidy ^dp Number Of Replicons ^dp Extrachromosomal Elements ^dp Estimated size ^dp Project Name ^dp Sample Name ^dp Taxonomy ID Of DNA Sample ^dp Negative Control Type ^dp Positive Control Type ^dp
Restriction	Sample Material Processing ^dp max 1 WGA Amplification Kit ^dp max 1 Experimental Factor ^dp max 1 Followed By ^op some Nucleotide Analysis ^c Followed By ^op only Nucleotide Analysis ^c Sample Name ^dp max 1 Subspecific Genetic Lineage ^dp max 1 Taxonomy ID Of DNA Sample ^dp max 1 Project Name ^dp max 1 Relation To Oxygen ^dp max 1 Broad-scale Environmental Context ^dp max 1 Isolation And Growth Condition ^dp max 1 Sample Collection Device ^dp max 1 Amount Or Size Of Sample Collected ^dp max 1 Contamination Screening Input ^dp max 1 Size Fraction Selected ^dp max 1 Assay Type ^dp max 1 Local Environmental Context ^dp max 1

Nucleotide Analysis ^c

IRI	`http://rs.tdwg.org/dwc/terms/NucleotideAnalysis`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A link between a [dwc:NucleotideSequence] and a [dwc:Event] and a [dwc:MaterialEntity] from which it was derived, using a specified [dwc:Protocol].
In Domain Of	Nucleotide Analysis ID ^dp Read Count ^dp Total Read Count ^dp Analysis Of ^op Material Collected During ^op Produced ^op
In Range Of	Analyzed In ^op Produced By ^op

Nucleotide Sequence ^c

IRI	`http://rs.tdwg.org/dwc/terms/NucleotideSequence`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A digital representation of a nucleotide sequence.
In Domain Of	Nucleotide Sequence ID ^dp Nucleotide Sequence Remarks ^dp Sequence ^dp Produced By ^op
In Range Of	Produced ^op
Restriction	Nucleotide Sequence ID ^dp exactly 1 Sequence ^dp exactly 1

Occurrence ^c

IRI	`http://rs.tdwg.org/dwc/terms/Occurrence`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A state of a [dwc:Organism] in a [dwc:Event].
Example	a fungus in Central Park in the summer of 1929 a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23 a wolf pack on the shore of Kluane Lake in 1988
In Domain Of	Occurrence Of (DSW) ^op Degree of Establishment ^dp Establishment Means ^dp Occurrence ID ^dp Occurrence Remarks ^dp Occurrence Status ^dp Pathway ^dp Has Evidence ^op Occurrence Of (DWCDP) ^op Recorded By (DWCDP) ^op
In Range Of	Evidence For ^op Interaction By ^op Interaction With ^op Recorded (DWCDP) ^op Target Occurrence ^op

Occurrence Assertion ^c

IRI	`http://rs.tdwg.org/dwc/terms/OccurrenceAssertion`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A [dwc:Assertion] made by a [dcterms:Agent] about a [dwc:Occurrence].
Sub Class Of	Assertion ^c
In Domain Of	Behavior ^dp
Restriction	About ^op some Occurrence ^c

Organism ^c

IRI	`http://rs.tdwg.org/dwc/terms/Organism`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Instances of the [dwc:Organism] class are intended to facilitate linking one or more [dwc:Identification] instances to one or more [dwc:Occurrence] instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids and lichens) and aggregates whose [dwc:Occurrence]s are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. A particular organism or defined group of organisms considered to be taxonomically homogeneous.
Example	a specific bird a specific instance of a bacterial culture a specific wolf pack
In Domain Of	Organism ID ^dp Organism Name ^dp Organism Remarks ^dp Organism Scope ^dp
In Range Of	Occurrence Of (DSW) ^op Occurrence Of (DWCDP) ^op

Organism Assertion ^c

IRI	`http://rs.tdwg.org/dwc/terms/OrganismAssertion`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A [dwc:Assertion] made by a [dcterms:Agent] about a [dwc:Organism].
Sub Class Of	Assertion ^c
Restriction	About ^op some Organism ^c

Organism Interaction ^c

IRI	`http://rs.tdwg.org/dwc/terms/OrganismInteraction`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Supports only primary observed interactions, not habitualor derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which the action is inferred, with the actor as the subject in [dwc:Occurrence] and the acted-upon as the related [dwc:Occurrence]. Only one direction of a two-way interaction is necessary, though both are permissible as distinct [dwc:OrganismInteraction]s with distinct subject [dwc:Occurrence]s. An interaction between two [dwc:Organism]s during a [dwc:Event].
Example	a Mallophora ruficauda hunting an Apis mellifera in flight a bee visiting a flower a female spider mating with a male spider a lion cub nursing from its mother a mosquito sucking blood from a chimpanzee's arm a slug eating a fungus growing on a decomposing stump (2 interactions) a viral infection in a plant
In Domain Of	Organism Interaction ID ^dp Interaction By ^op Interaction With ^op
Restriction	Interaction With ^op only Occurrence ^c Interaction By ^op some Occurrence ^c Interaction With ^op some Occurrence ^c Interaction By ^op only Occurrence ^c

Organism Interaction Agent Role ^c

IRI	`http://rs.tdwg.org/dwc/terms/OrganismInteractionAgentRole`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A relationship of one [rdfs:Resource] ([http://www.w3.org/2000/01/rdf-schema#Resource]) to another.
Sub Class Of	Resource Relationship ^c
Restriction	Relationship Of ^op exactly 1 Relationship To ^op exactly 1

Organism Relationship ^c

IRI	`http://rs.tdwg.org/dwc/terms/OrganismRelationship`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A [dwc:OrganismRelationship] must be a permanent relationship. Ephemeral relationships between [dwc:Organism]s should be recorded as [dwc:OrganismInteraction]s. A [dwc:ResourceRelationship] of one [dwc:Organism] to another [dwc:Organism].
Sub Class Of	Resource Relationship ^c
Restriction	Relationship Of ^op only Organism ^c Relationship To ^op only Organism ^c Relationship To ^op some Organism ^c Relationship Of ^op some Organism ^c

Permit ^c

IRI	`http://rs.tdwg.org/dwc/terms/Permit`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A document, allowing for the execution of certain activities.
Example	a license to put up mist-nets to sample for bird communities
In Domain Of	Allows For ^op Has Permit Status ^op Has Permit Type ^op Issued By ^op

Protocol ^c

IRI	`http://rs.tdwg.org/dwc/terms/Protocol`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A method used during an action.
Example	a Bayesian phylogenetic inference method a linear regression model to estimate body mass from skeletal measurements a pitfall method for sampling ground-dwelling arthropods a point-radius georeferencing method
In Domain Of	Protocol Description ^dp Protocol ID ^dp Protocol ID ^dp Protocol Remarks ^dp Protocol Type ^dp Followed By ^op Protocol References ^dp
In Range Of	Follows ^op
Super Class Of	Molecular Protocol ^c

Provenance ^c

IRI	`http://rs.tdwg.org/dwc/terms/Provenance`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This is a convenience class to group related properties. Information about an entity's origins.
In Domain Of	Funding Attribution ^dp Funding Attribution ID ^dp Creator ^dp Dataset ID ^dp Project ID ^dp Project Title ^dp Funded By ^op

Resource Relationship ^c

IRI	`http://rs.tdwg.org/dwc/terms/ResourceRelationship`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of [dwc:Occurrence], [dwc:Organism], [dwc:MaterialEntity], [dwc:Event], [dcterms:Location], [dwc:GeologicalContext], [dwc:Identification], or [dwc:Taxon.] A relationship of one [rdfs:Resource] ([http://www.w3.org/2000/01/rdf-schema#Resource]) to another.
Example	a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence an instance of a dwc:Organism is the mother of another instance of a dwc:Organism
In Domain Of	Relationship Established Date ^dp Relationship Of Resource ID ^op Relationship Remarks ^dp Relationship Type (IRI) ^op Resource ID ^dp Resource Relationship ID ^dp
Super Class Of	Organism Interaction Agent Role ^c Organism Relationship ^c

Subject Orientation ^c

IRI	`http://rs.tdwg.org/dwc/terms/SubjectOrientation`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Controlled value for Darwin Core terms for Audiovisual Core subject orientation.
Sub Class Of	Concept ^c
In Range Of	Has Subject Orientation ^op

Subject Part ^c

IRI	`http://rs.tdwg.org/dwc/terms/SubjectPart`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Controlled value for Darwin Core terms for Audiovisual Core subject part.
Sub Class Of	Concept ^c
In Range Of	Has Subject Part ^op

Taxon ^c

IRI	`http://rs.tdwg.org/dwc/terms/Taxon`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A group of organisms (sensu http://purl.obolibrary.org/obo/OBI_0100026 considered by taxonomists to form a homogeneous unit.
In Domain Of	Taxon For ^op
In Range Of	To Taxon (DWCDP) ^op

Type Designation Type ^c

IRI	`http://rs.tdwg.org/dwc/terms/TypeDesignationType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	From https://rs.gbif.org/extension/gbif/1.0/typesandspecimen.xml. A category that best matches the nature of a type designation.
Sub Class Of	Concept ^c
In Range Of	Type Designation Type ^op

Usage Policy ^c

IRI	`http://rs.tdwg.org/dwc/terms/UsagePolicy`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This is a convenience class to group related properties. Information about rights, usage, and attribution statements applicable to an entity.
In Domain Of	Rights ^op Usage Policy ID ^dp

Survey ^c

IRI	`http://rs.tdwg.org/eco/terms/Survey`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	This class includes properties found in the Humboldt Extension to Darwin Core ([eco:]), except for target scope terms, which can be accomodated in [eco:SurveyTarget]. A biotic survey or inventory.
Example	a botanical survey of a protected area to assess native and invasive plant species a camera trap deployment in a rainforest to monitor large mammals a coverboard survey for reptiles in forested environments a frog call survey in wetlands across breeding seasons a habitat- or ecosystem-level survey (e.g. coral reef health assessment, forest biodiversity assessment) a macroinvertebrate sampling in a freshwater stream to assess water quality a pollinator survey in an agricultural landscape a wetland vegetation mapping an environmental impact assessment (e.g. pre-construction baseline survey for a wind farm project)
In Domain Of	Survey ID ^dp Has Target ^op Identifications By ^op Sampling Performed By ^op Site Count ^dp Site Nesting Description ^dp Verbatim Site Description ^dp Verbatim Site Names ^dp
In Range Of	Target For ^op

Survey Target ^c

IRI	`http://rs.tdwg.org/eco/terms/SurveyTarget`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	An intended scope for [dwc:Occurrence]s in a [eco:Survey].
Example	Oncorhynchus mykiss and Oncorhynchus clarkii (only) all bird species all bird species except Larus gulls, fulmars and kittiwakes all total lengths except < 12 inches reproductive female Ctenomys sociabilis (only)
In Domain Of	Survey Target ID ^dp Survey Target Type ^dp Survey Target Type Source ^dp Target For ^op Include Or Exclude ^dp Is Survey Target Fully Reported ^dp
In Range Of	Has Target ^op

Concept ^c

IRI	`http://www.w3.org/2004/02/skos/core#Concept`
Is Defined By	http://www.w3.org/2004/02/skos/core#
Description	An idea or notion; a unit of thought.
Super Class Of	Permit Status Vocabulary ^c Permit Type Vocabulary ^c Degree Of Establishment ^c Establishment Means ^c Subject Orientation ^c Subject Part ^c Type Designation Type ^c

Concept Scheme ^c

IRI	`http://www.w3.org/2004/02/skos/core#ConceptScheme`
Is Defined By	http://www.w3.org/2004/02/skos/core#
Description	A set of concepts, optionally including statements about semantic relationships between those concepts.
In Range Of	is in scheme ^op

Object Properties

Contributor (DCTERMS) ^op

IRI	`http://purl.org/dc/terms/contributor`
Is Defined By	DCMI Metadata Terms
Description	The guidelines for using names of persons or organizations as creators apply to contributors. An entity responsible for making contributions to this resource.
Super Property Of	Authored By ^op

Creator (DCTERMS) ^op

IRI	`http://purl.org/dc/terms/creator`
Is Defined By	DCMI Metadata Terms
Description	Recommended practice is to identify the creator with a URI. If this is not possible or feasible, a literal value that identifies the creator may be provided. An entity responsible for making the resource.
Super Property Of	Authored By ^op Created By ^op

Publisher (DCTERMS) ^op

IRI	`http://purl.org/dc/terms/publisher`
Is Defined By	DCMI Metadata Terms
Description	An entity responsible for making the resource available.
Super Property Of	Published By ^op

Rights (DCTERMS) ^op

IRI	`http://purl.org/dc/terms/rights`
Is Defined By	DCMI Metadata Terms
Description	Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights. Recommended practice is to refer to a rights statement with a URI. If this is not possible or feasible, a literal value (name, label, or short text) may be provided. Information about rights held in and over the resource.
Domain	Usage Policy ^c

Rights Holder ^op

IRI	`http://purl.org/dc/terms/rightsHolder`
Is Defined By	DCMI Metadata Terms
Description	Recommended practice is to refer to the rights holder with a URI. If this is not possible or feasible, a literal value that identifies the rights holder may be provided. A person or organization owning or managing rights over the resource.
Super Property Of	Rights Held By ^op

Spatial Coverage ^op

IRI	`http://purl.org/dc/terms/spatial`
Is Defined By	DCMI Metadata Terms
Description	Spatial characteristics of the resource.
Super Property Of	Spatial Location ^op

Type ^op

IRI	`http://purl.org/dc/terms/type`
Is Defined By	DCMI Metadata Terms
Description	Recommended practice is to use a controlled vocabulary such as the DCMI Type Vocabulary DCMI-TYPE. To describe the file format, physical medium, or dimensions of the resource, use the property Format. The nature or genre of the resource.
Super Property Of	Survey Target Type IRI ^op

Located At ^op

IRI	`http://purl.org/dsw/locatedAt`
Is Defined By	http://purl.org/dsw/
Description	The dsw:locatedAt relationship is many-to-one (many events at one location). This property is preferred over its inverse if the link is made in only one direction. Links a subject dwc:Event instance to an object dcterms:Location instance.
Domain	Event ^c
Range	Location ^c

Occurrence Of (DSW) ^op

IRI	`http://purl.org/dsw/occurrenceOf`
Is Defined By	http://purl.org/dsw/
Description	The dsw:occurrrenceOf relationship is many-to-one (many occurrences for one individual organism). This property is preferred over its inverse if the link is made in only one direction. Links a subject dwc:Occurrence instance to an object dwc:Organism instance.
Domain	Occurrence ^c
Range	Organism ^c

Status ^op

IRI	`http://purl.org/ontology/bibo/status`
Is Defined By	http://purl.org/ontology/bibo/
Description	We are not defining, using an enumeration, the range of the bibo:status to the defined list of bibo:DocumentStatus. We won't do it because we want people to be able to define new status if needed by some special usecases. Creating such an enumeration would restrict this to happen. The publication status of (typically academic) content.
Domain	Document (BIBO) ^c
Range	Document Status ^c

Commenter ^op

IRI	`http://rs.tdwg.org/ac/terms/commenter`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	See also Reviewer Comments for the distinction betweeen Comments and Reviewer Comments. See also the entry for [ac:commenterLiteral] and the section Namespaces, Prefixes and Term Names in the Audiovisual Core Term List document for discussion of the rationale for separate terms taking URI values from those taking Literal values where both are possible. Normal practice is to use the same Label if both are provided. Labels have no effect on information discovery and are only suggestions. A URI denoting a person who created a comment.
Super Property Of	Commented By ^op

Metadata Creator ^op

IRI	`http://rs.tdwg.org/ac/terms/metadataCreator`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	See also the entry for [ac:metadataCreatorLiteral] and the section Namespaces, Prefixes and Term Names in the Audiovisual Core Term List document for discussion of the rationale for separate terms taking URI values from those taking Literal values where both are possible. Normal practice is to use the same Label if both are provided. Labels have no effect on information discovery and are only suggestions. URI of person or organization originally creating the resource metadata record.
Super Property Of	Metadata Creator (DWCDP) ^op

Metadata Provider ^op

IRI	`http://rs.tdwg.org/ac/terms/metadataProvider`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Media resources and their metadata may be served from different institutions, e.g. in the case of aggregators adding user annotations, taxon identifications, or ratings. Compare Provider. See also the entry for [ac:metadataProviderLiteral] and the section Namespaces, Prefixes and Term Names in the Audiovisual Core Term List document for discussion of the rationale for separate terms taking URI values from those taking Literal values where both are possible. Normal practice is to use the same Label if both are provided. Labels have no effect on information discovery and are only suggestions. URI of person or organization originally responsible for providing the resource metadata record.
Super Property Of	Metadata Provider (DWCDP) ^op

Reviewer ^op

IRI	`http://rs.tdwg.org/ac/terms/reviewer`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Provider is asserting they accept this review as competent. See also [ac:reviewerLiteral] and the section Namespaces, Prefixes and Term Names in the Audiovisual Core Term List documentation for discussion of the rationale for separate terms taking URI values from those taking Literal values where both are possible. Normal practice is to use the same Label if both are provided. Labels have no effect on information discovery and are only suggestions. URI for a reviewer.
Super Property Of	Reviewed By ^op

Assertion Type (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/assertionTypeIRI`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use an IRI for a term in a controlled vocabulary. An IRI of a controlled vocabulary value for a type of [dwc:Assertion].

Assertion Value (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/assertionValueIRI`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	An IRI of the controlled vocabulary value for a value of a [dwc:Assertion].
Example	http://purl.obolibrary.org/obo/OBA_VT0000047

Behavior (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/behavior`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A description of the behavior shown by the subject at the time the dwc:Occurrence was recorded.

Caste (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/caste`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary that aligns best with the dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. Categorisation of individuals for eusocial species (including some mammals and arthropods).

Data Generalizations (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/dataGeneralizations`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.

Degree Of Establishment (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/degreeOfEstablishment`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Example	Cultivated (category B2) Failing (category C0)

Discipline (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/discipline`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The primary branch or branches of knowledge represented by the record.

Disposition (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/disposition`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The current state of a specimen with respect to the collection identified in dwc:collectionCode or dwc:collectionID.

Earliest Geochronological Era ^op

IRI	`http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details. Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.

Establishment Means (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/establishmentMeans`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Example	http://rs.tdwg.org/dwcem/values/e001 http://rs.tdwg.org/dwcem/values/e005

Event Type (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/eventType`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Regardless of the dwc:eventType, the interval of the dwc:Event can be captured in dwc:eventDate. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The nature of the dwc:Event.

Field Notes (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/fieldNotes`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes. One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.

Field Number (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/fieldNumber`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	The subject is a (possibly IRI-identified) resource that is the field notes and the object is a dwc:Event instance. An identifier given to the event in the field. Often serves as a link between field notes and the dwc:Event.
Domain	Event ^c

Footprint WKT (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/footprintWKT`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.

Geodetic Datum (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/geodeticDatum`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value not recorded. The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.

Georeference Protocol (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/georeferenceProtocol`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A description or reference to the methods used to determine the spatial footprint, coordinates, and uncertainties.

Georeference Sources (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/georeferenceSources`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A map, gazetteer, or other resource used to georeference the dcterms:Location.

Georeference Verification Status (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.

Georeferenced By (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/georeferencedBy`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A person, group, or organization who determined the georeference (spatial representation) for the dcterms:Location.
Super Property Of	Georeferenced By ^op

Habitat (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/habitat`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A category or description of the habitat in which the dwc:Event occurred.

Identified By (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/identifiedBy`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	When used in the context of an Event (such as in the Humboldt Extension), the subject consists of all of the dwc:Organisms related to the Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A person, group, or organization who assigned the dwc:Taxon to the subject.
Super Property Of	Identified By ^op

Location According To (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/locationAccordingTo`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.

Occurrence Status (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/occurrenceStatus`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A statement about the presence or absence of a dwc:Taxon at a dcterms:Location.

Pathway (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/pathway`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The process by which a dwc:Organism came to be in a given place at a given time.
Example	http://rs.tdwg.org/dwcpw/values/p002 http://rs.tdwg.org/dwcpw/values/p046

Recorded By (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/recordedBy`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. A person, group, or organization responsible for recording the original dwc:Occurrence.
Super Property Of	Recorded By (DWCDP) ^op

Reproductive Condition (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/reproductiveCondition`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The reproductive condition of the biological individual(s) represented in the dwc:Occurrence.

Sampling Protocol (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/samplingProtocol`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is describe a dwc:Event with no more than one sampling protocol. In the case of a summary dwc:Event in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence. The methods or protocols used during a dwc:Event, denoted by an IRI.
Example	https://doi.org/10.1111/j.1466-8238.2009.00467.x

Survey Target Type IRI ^op

IRI	`http://rs.tdwg.org/dwc/iri/surveyTargetTypeIRI`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use an IRI for a term in a controlled vocabulary. A reference to a controlled vocabulary in which the definition of a value in [eco:SurveyTargetType] is given.
Sub Property Of	Type ^op

To Taxon (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/toTaxon`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details. Use to link a [dwc:Identification] instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Super Property Of	To Taxon (DWCDP) ^op

Verbatim Coordinate System (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The spatial coordinate system for the dwc:verbatimLatitude and dwc:verbatimLongitude or the dwc:verbatimCoordinates of the dcterms:Location.

Verbatim SRS (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/verbatimSRS`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`. The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.

Vertical Datum (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/verticalDatum`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. The vertical datum used as the reference upon which the values in the elevation terms are based.

Vitality (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/iri/vitality`
Is Defined By	http://rs.tdwg.org/dwc/iri/
Description	Recommended best practice is to use a controlled vocabulary. Intended to be used with records having a dwc:basisOfRecord of `PreservedSpecimen`, `MaterialEntity`, `MaterialSample`, or `HumanObservation`. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.

Has Subject Orientation ^op

IRI	`http://rs.tdwg.org/dwc/terms/hasSubjectOrientation`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Object property to relate a ac:Media instance to a controlled IRI value from the acorient vocabulary.
Domain	Media ^c
Range	Subject Orientation ^c

Has Subject Part ^op

IRI	`http://rs.tdwg.org/dwc/terms/hasSubjectPart`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Object property to relate a ac:Media instance to a controlled IRI value from the acpart vocabulary.
Domain	Media ^c
Range	Subject Part ^c

Relationship Of Resource ID ^op

IRI	`http://rs.tdwg.org/dwc/terms/relationshipOfResourceID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology. An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID.
Example	http://purl.obolibrary.org/obo/RO_0002455 http://purl.obolibrary.org/obo/RO_0002456 https://www.inaturalist.org/observation_fields/879
Super Property Of	Relationship Type (IRI) ^op
Domain	Resource Relationship ^c

Relationship Type (IRI) ^op

IRI	`http://rs.tdwg.org/dwc/terms/relationshipTypeIRI`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use an IRI for a term in a controlled vocabulary. An IRI of a controlled vocabulary value for the type of a dwc:ResourceRelationship.
Example	http://purl.obolibrary.org/obo/RO_0002455 http://purl.obolibrary.org/obo/RO_0002456 https://www.inaturalist.org/observation_fields/879
Sub Property Of	Relationship Of Resource ID ^op
Domain	Resource Relationship ^c

About ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/about`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The object of this property can be an instance of [ac:Media], [chrono:ChronometricAge], [dwc:Event], [dwc:MaterialEntity], [dwc:NucleotideAnalysis], [dwc:Occurrence], [dwc:Organism] or [dwc:OrganismInteraction]. An [owl:ObjectProperty] used to relate a [dwc:Assertion] to the object it is about.
Domain	Assertion ^c
Range	Chronometric Age ^c or Occurrence ^c or Event ^c or Organism ^c or Material Entity ^c or Organism Interaction ^c or Media ^c or Nucleotide Analysis ^c

Allows For ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/allowsFor`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The allowed activities can be varied, and include [dwc:Event], [dwc:NucleotideAnalysis] and [eco:Survey]. An [owl:ObjectProperty] used to relate a [dwc:Permit] to the activities it allows for.
Domain	Permit ^c
Range	Nucleotide Analysis ^c or Survey ^c or Event ^c

Analysis Of ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/analysisOf`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:NucleotideAnalysis] to the [dwc:MaterialEntity] of which it is an analysis of.
Domain	Nucleotide Analysis ^c
Range	Material Entity ^c

Analyzed In ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/analyzedIn`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:MaterialEntity] to the [dwc:NucleotideAnalysis] of which it is analysis of.
Domain	Material Entity ^c
Range	Nucleotide Analysis ^c

Asserted ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/asserted`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dcterms:Agent] to the [dwc:Assertion] that it made.
Domain	Agent ^c
Range	Assertion ^c

Asserted By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/assertedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Assertion] to the [dcterms:Agent] that asserted it.
Domain	Assertion ^c
Range	Agent ^c

Authored By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/authoredBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dcterms:BibliographicResource] to the [dcterms:Agent] that authored it.
Sub Property Of	Contributor ^op Creator ^op
Domain	Bibliographic Resource ^c
Range	Agent ^c

Based On ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/basedOn`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The entities upon which identifications can be based on include [ac:Media], [dcterms:BibliographicResource], [dwc:MaterialEntity], [dwc:NucleotideSequence] and [dwc:Occurrence]. An [owl:ObjectProperty] used to relate a [dwc:Identification] to the entity on which it is based.
Domain	Identification ^c
Range	Material Entity ^c or Nucleotide Sequence ^c or Occurrence ^c or Media ^c or Bibliographic Resource ^c

Collected During ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/collectedDuring`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:MaterialEntity] to the [dwc:Event] during which it was collected.
Domain	Material Entity ^c
Range	Event ^c

Commented By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/commentedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [ac:Media] to the [dcterms:Agent] that commented on it.
Sub Property Of	Commenter ^op
Domain	Media ^c
Range	Agent ^c

Conducted By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/conductedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Event] to the [dcterms:Agent] that conducted it.
Domain	Event ^c
Range	Agent ^c

Created By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/createdBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The types of created resources include [ac:Media] and [dwc:Provenance]. An [owl:ObjectProperty] used to relate a resource to the to the [dcterms:Agent] that created it.
Sub Property Of	Creator ^op
Domain	Media ^c or Provenance ^c
Range	Agent ^c

Dated Material ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/datedMaterial`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [chrono:ChronometricAge] to the [dwc:MaterialEntity] it represents the age of.
Domain	Chronometric Age ^c
Range	Material Entity ^c

Derived From ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/derivedFrom`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	Though the [rdfs:domain] and [rdfs:range] of this property are varied, universal restrictions on the classes prevent cross-class use of the term. An [owl:ObjectProperty] used to relate a subject entity to the entity from which it was derived.
Domain	Media ^c or Material Entity ^c
Range	Material Entity ^c or Media ^c

Edited By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/editedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dcterms:BibliographicResource] to the [dcterms:Agent] that edited it.
Domain	Bibliographic Resource ^c
Range	Agent ^c

Evidence For ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/evidenceFor`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	This property also has a [owl:InverseProperty], [dwcdp:hasEvidence], which allows reasoners queries to go through different ways. An [owl:ObjectProperty] used to relate an entity to an instance of [dwc:Occurrence]. These entities can be [ac:Media], [dcterms:BibliographicResource], [dwc:MaterialEntity], [dwc:NucleotideSequence].
Domain	Material Entity ^c or Nucleotide Sequence ^c or Media ^c or Bibliographic Resource ^c
Range	Occurrence ^c

Follows ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/followed`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The considered resources can be varied and include [chrono:ChronometricAge], [dwc:Assertion], [dwc:Event], [dwc:MaterialEntity], [dwc:NucleotideAnalysis], [dwc:Occurrence], [eco:Survey]. An [owl:ObjectProperty] used to relate a resource to the [dwc:Protocol] it followed.
Domain	Assertion ^c or Occurrence ^c or Nucleotide Analysis ^c or Event ^c or Survey ^c or Material Entity ^c or Chronometric Age ^c
Range	Protocol ^c

Followed By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/followedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The considered resources can be varied and include [chrono:ChronometricAge], [dwc:Assertion], [dwc:Event], [dwc:MaterialEntity], [dwc:NucleotideAnalysis], [dwc:Occurrence], [eco:Survey]. An [owl:ObjectProperty] used to relate a [dwc:Protocol] to the entities it is followed by.
Domain	Protocol ^c
Range	Material Entity ^c or Chronometric Age ^c or Assertion ^c or Occurrence ^c or Event ^c or Survey ^c or Nucleotide Analysis ^c

Funded By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/fundedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Provenance] to a [dcterms:Agent] that funded it.
Domain	Provenance ^c
Range	Agent ^c

Georeferenced By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/georeferencedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dcterms:Location] to a [dcterms:Agent] that georeferenced it.
Sub Property Of	Georeferenced By (IRI) ^op
Domain	Location ^c
Range	Agent ^c

Happened During ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/happenedDuring`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Event] to its parent [dwc:Event].
Domain	Occurrence ^c or Organism Interaction ^c or Survey ^c or Event ^c
Range	Event ^c

Happened Within ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/happenedWithin`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate either a [dwc:MaterialEntity] or a [dwc:Occurrence] to the [dwc:GeologicalContext] within which it happened.
Domain	Occurrence ^c or Material Entity ^c
Range	Geological Context ^c

Has Evidence ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/hasEvidence`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	This property also has a [owl:InverseProperty], [dwcdp:evidenceFor], which allows reasoners queries to go through different ways. An [owl:ObjectProperty] used to relate an instance of [dwc:Occurrence] to various entities which are evidence for it. These entities can be [ac:Media], [dcterms:BibliographicResource], [dwc:MaterialEntity], [dwc:NucleotideSequence].
Domain	Occurrence ^c
Range	Material Entity ^c or Nucleotide Sequence ^c or Media ^c or Bibliographic Resource ^c

Has Media ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/hasMedia`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	This property also has a [owl:InverseProperty], [dwcdp:mediaOf], which allows reasoners queries to go through different ways. An [owl:ObjectProperty] used to relate an entity to an instance of [ac:Media]. These entities can be [chrono:ChronometricAge], [dcterms:Agent], [dcterms:BibliographicResource], [dwc:Event], [dwc:GeologicalContext], [dwc:MaterialEntity], [dwc:Occurrence], [dwc:OrganismInteraction].
Domain	Geological Context ^c or Chronometric Age ^c or Agent ^c or Material Entity ^c or Organism Interaction ^c or Bibliographic Resource ^c or Occurrence ^c or Event ^c
Range	Media ^c

Has Permit Status ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/hasPermitStatus`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Permit] to concepts associated in [ggbn:permitStatus_vocabulary].
Domain	Permit ^c
Range	Permit Status Vocabulary ^c

Has Permit Type ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/hasPermitType`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Permit] to concepts associated in [ggbn:permitType_vocabulary].
Domain	Permit ^c
Range	Permit Type Vocabulary ^c

Has Target ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/hasTarget`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [eco:Survey] to the [eco:SurveyTarget] it has as a target.
Domain	Survey ^c
Range	Survey Target ^c

Identifications By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/identificationsBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The property [dwcdp:identificationsBy] should not be confused with [dwcdp:identifiedBy], which has a different [rdfs:domain]. The former applies to a [eco:Survey], whereas the latter applies to a [dwc:Identification]. An [owl:ObjectProperty] used to relate a [eco:Survey] to a [dwc:Agent] who conducted the identifications for it.
Domain	Survey ^c
Range	Agent ^c

Identified By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/identifiedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	Resources that can be identified include [dwc:Identification], [dwc:MaterialEntity] and [dwc:Occurrence]. An [owl:ObjectProperty] used to relate a resource to a [dwc:Agent] that identified it.
Sub Property Of	Identified By (IRI) ^op
Domain	Material Entity ^c or Identification ^c or Occurrence ^c
Range	Agent ^c

Interaction By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/interactionBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	To keep the interaction terms semantically correct and in order, the [dwc:Occurrence] considered by this property should be the subject of the statement. An [owl:ObjectProperty] used to relate a [dwc:OrganismInteraction] to the [dwc:Occurrence] it involves.
Domain	Organism Interaction ^c
Range	Occurrence ^c

Interaction With ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/interactionWith`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	To keep the interaction terms semantically correct and in order, the [dwc:Occurrence] considered by this property should be the object of the statement. An [owl:ObjectProperty] used to relate a [dwc:OrganismInteraction] to the [dwc:Occurrence] it involves.
Domain	Organism Interaction ^c
Range	Occurrence ^c

Issued By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/issuedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Permit] to the [dcterms:Agent] that issued it.
Domain	Permit ^c
Range	Agent ^c

Material Collected During ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/materialCollectedDuring`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:NucleotideAnalysis] to the [dwc:Event] from which the material was collected.
Domain	Nucleotide Analysis ^c
Range	Event ^c

Media Of ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/mediaOf`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	This property also has a [owl:InverseProperty], [dwcdp:hasMedia], which allows reasoners queries to go through different ways. An [owl:ObjectProperty] used to relate an instance of [ac:Media] to an entity of which it is a media of. These entities can be [chrono:ChronometricAge], [dcterms:Agent],[dcterms:BibliographicResource], [dwc:Event], [dwc:GeologicalContext], [dwc:MaterialEntity], [dwc:Occurrence], [dwc:OrganismInteraction].
Domain	Media ^c
Range	Chronometric Age ^c or Organism Interaction ^c or Geological Context ^c or Agent ^c or Occurrence ^c or Bibliographic Resource ^c or Material Entity ^c or Event ^c

Mentioned In ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/mentionedIn`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The mentionable resources include [chrono:ChronometricAge], [dwc:Event], [dwc:Identification], [dwc:MaterialEntity], [dwc:Occurrence], [dwc:Organism], [dwc:OrganismInteraction], [dwc:Protocol] and [eco:Survey]. An [owl:ObjectProperty] used to relate a resource to a [dcterms:BibliographicResource] where it was mentioned.
Domain	Occurrence ^c or Chronometric Age ^c or Survey ^c or Protocol ^c or Event ^c or Organism ^c or Identification ^c or Organism Interaction ^c or Material Entity ^c
Range	Bibliographic Resource ^c

Mentions ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/mentions`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	This property also has a [owl:InverseProperty], [dwcdp:mediaOf], which allows reasoners queries to go through different ways. An [owl:ObjectProperty] used to relate an entity to an instance of [ac:Media]. These entities can be [chrono:ChronometricAge], [dcterms:Agent], [dwc:Event], [dwc:GeologicalContext], [dwc:MaterialEntity], [dwc:Occurrence], [dwc:OrganismInteraction]
Domain	Bibliographic Resource ^c
Range	Identification ^c or Organism Interaction ^c or Organism ^c or Material Entity ^c or Protocol ^c or Occurrence ^c or Chronometric Age ^c or Survey ^c or Event ^c

Metadata Creator (DWCDP) ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/metadataCreator`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The domain of this property can be either [ac:Media] or [dwc:Provenance]. An owl:ObjectProperty relating a resource to the [dcterms:Agent] responsible for creating its associated metadata.
Sub Property Of	Metadata Creator ^op
Domain	Media ^c or Provenance ^c
Range	Agent ^c

Metadata Provider (DWCDP) ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/metadataProvider`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The domain of this property can be either [ac:Media] or [dwc:Provenance]. An owl:ObjectProperty relating a resource to the [dcterms:Agent] responsible for providing its associated metadata.
Sub Property Of	Metadata Provider ^op
Domain	Provenance ^c or Media ^c
Range	Agent ^c

Occurrence Of (DWCDP) ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/occurrenceOf`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Occurrence] to the [DWC:Organism] it is an occurrence of.
Domain	Occurrence ^c
Range	Organism ^c

Owned By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/ownedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:MaterialEntity] to the [dcterms:Agent] which owns it.
Domain	Material Entity ^c
Range	Agent ^c

Part Of ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/partOf`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	Though the [rdfs:domain] and [rdfs:range] of this property are varied, universal restrictions on the classes prevent cross-class use of the term. An [owl:ObjectProperty] used to relate a subject entity to the entity from which it was derived.
Domain	Bibliographic Resource ^c or Material Entity ^c or Media ^c
Range	Media ^c or Bibliographic Resource ^c or Material Entity ^c

Produced ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/produced`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:NucleotideAnalysis] to the [dwc:NucleotideSequences] that it produced.
Domain	Nucleotide Analysis ^c
Range	Nucleotide Sequence ^c

Produced By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/producedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:NucleotideSequence] to the [dwc:NucleotideAnalysis] that produced it.
Domain	Nucleotide Sequence ^c
Range	Nucleotide Analysis ^c

Published By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/publishedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dcterms:BibliographicResource] to the [dcterms:Agent] that published it.
Sub Property Of	Publisher ^op
Domain	Provenance ^c or Bibliographic Resource ^c
Range	Agent ^c

Recorded (DWCDP) ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/recorded`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	A person, group, or organization responsible for recording the original dwc:Occurrence.
Domain	Agent ^c
Range	Occurrence ^c

Recorded By (DWCDP) ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/recordedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	A person, group, or organization responsible for recording the original dwc:Occurrence.
Sub Property Of	Recorded By (IRI) ^op
Domain	Occurrence ^c
Range	Agent ^c

Relationship Of ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/relationshipOf`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	To keep the interaction terms semantically correct and in order, the resource considered by this property should be the subject of the statement. An [owl:ObjectProperty] used to relate [dwc:ResourceRelationship] to the resource it involves.

Relationship To ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/relationshipTo`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	To keep the interaction terms semantically correct and in order, the resource considered by this property should be the object of the statement. An [owl:ObjectProperty] used to relate [dwc:ResourceRelationship] to the resource it involves.

Reviewed By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/reviewedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Media] to the [dcterms:Agent] that reviewed it.
Sub Property Of	Reviewer ^op
Domain	Media ^c
Range	Agent ^c

Rights Held By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/rightsHeldBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	In the context of Darwin Core, these resources include ac:Media and dwc:MaterialEntity. An [owl:ObjectProperty] used to relate a resource to the [dcterms:Agent] that holds rights over it.
Sub Property Of	Rights Holder ^op
Domain	Material Entity ^c or Media ^c
Range	Agent ^c

Sampling Performed By ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/samplingPerformedBy`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [eco:Survey] to the [dcterms:Agent] that carried out the sampling.
Sub Property Of	Sampling Performed By (IRI) ^op
Domain	Survey ^c
Range	Agent ^c

Spatial Location ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/spatialLocation`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Event] to the [dcterms:Location] it spatially occurred in.
Sub Property Of	Spatial Coverage ^op
Domain	Event ^c
Range	Location ^c

Stored In ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/storedIn`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:MaterialEntity] to the [dcterms:Agent] in which it is stored.
Domain	Material Entity ^c
Range	Agent ^c

Target For ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/targetFor`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [eco:SurveyTarget] to the [eco:Survey] it is a target for.
Domain	Survey Target ^c
Range	Survey ^c

Target Occurrence ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/targetOccurrence`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Identification] to the [dwc:Occurrence] it identifies.
Domain	Identification ^c
Range	Occurrence ^c

Taxon For ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/taxonFor`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Taxon] to the [dwc:Identification] it is used for.
Domain	Taxon ^c
Range	Identification ^c

To Taxon (DWCDP) ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/toTaxon`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:Identification] to the [dwc:Taxon] it considers.
Sub Property Of	To Taxon (IRI) ^op
Domain	Identification ^c
Range	Taxon ^c

Type Designation Type ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/typeDesignationType`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	The class [dwc:TypeDesignationType] considers a finite set of named individuals. An [owl:ObjectProperty] used to relate a [dwc:Identification] to an instance of a [dwc:TypeDesignationType].
Domain	Identification ^c
Range	Type Designation Type ^c

Used ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/used`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	This property also has a [owl:InverseProperty], [dwcdp:mediaOf], which allows reasoners queries to go through different ways. An [owl:ObjectProperty] used to relate an entity to an instance of [ac:Media]. These entities can be [chrono:ChronometricAge], [dcterms:Agent], [dwc:Event], [dwc:GeologicalContext], [dwc:MaterialEntity], [dwc:Occurrence], [dwc:OrganismInteraction]
Domain	Identification ^c
Range	Bibliographic Resource ^c

Used For ^op

IRI	`http://rs.tdwg.org/dwcdp/terms/usedFor`
Is Defined By	http://rs.tdwg.org/dwcdp/terms/
Description	An [owl:ObjectProperty] used to relate a [dwc:BibliographicResource] to an instance of a [dwc:Identification] it was used to determine.
Domain	Bibliographic Resource ^c
Range	Identification ^c

Sampling Performed By (IRI) ^op

IRI	`http://rs.tdwg.org/eco/iri/samplingPerformedBy`
Is Defined By	http://rs.tdwg.org/eco/iri/
Description	The sampling dwc:Event could be at any level of hierarchy. In the case of a higher level (parent) dwc:Event, include all the organizations or people involved in the child dwc:Events that contributed to the parent dwc:Event. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects. A person, group, or organization responsible for recording the dwc:Event.
Super Property Of	Sampling Performed By ^op

Survey Target Type Source IRI ^op

IRI	`http://rs.tdwg.org/eco/iri/surveyTargetTypeSourceIRI`
Is Defined By	http://rs.tdwg.org/eco/iri/
Description	Recommended best practice is to use an IRI for a controlled vocabulary. This term is to be used only with IRI values and not strings. A reference to a controlled vocabulary in which the definition of a value in [eco:surveyTargetValue] is given.
Sub Property Of	Source ^dp

Is In Scheme ^op

IRI	`http://www.w3.org/2004/02/skos/core#inScheme`
Is Defined By	http://www.w3.org/2004/02/skos/core#
Description	A conceptmay be a member of more than one concept scheme. Relates a resource (for example a concept) to a concept scheme in which it is included
Range	Concept Scheme ^c

Datatype Properties

DNA Concentration ^dp

IRI	`http://data.ggbn.org/schemas/ggbn/terms/concentration`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Concentration of DNA (weight ng/volume µL).
Example	67.5
Domain	Molecular Protocol ^c
Range	xsd:decimal

DNA Concentration Unit ^dp

IRI	`http://data.ggbn.org/schemas/ggbn/terms/concentrationUnit`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Unit used for [ggbn:concentration] measurement.
Example	ng/µL
Domain	Molecular Protocol ^c
Range	Literal

Method For Concentration Measurement ^dp

IRI	`http://data.ggbn.org/schemas/ggbn/terms/methodDeterminationConcentrationAndRatios`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Description of method used for [ggbn:concentration] measurement.
Example	Nanodrop Qubit
Domain	Molecular Protocol ^c
Range	Literal

Ratio Of Absorbance At 260 nm and 230 nm ^dp

IRI	`http://data.ggbn.org/schemas/ggbn/terms/ratioOfAbsorbance260_230`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Ratio of absorbance at 260 nm and 230 nm assessing DNA purity (mostly secondary measure, indicates mainly EDTA, carbohydrates, phenol), (DNA samples only).
Example	1.89
Domain	Molecular Protocol ^c
Range	xsd:decimal

Ratio Of Absorbance At 260 nm and 280 nm ^dp

IRI	`http://data.ggbn.org/schemas/ggbn/terms/ratioOfAbsorbance260_280`
Is Defined By	http://data.ggbn.org/schemas/ggbn/terms/
Description	Ratio of absorbance at 260 nm and 280 nm assessing DNA purity (mostly secondary measure, indicates mainly EDTA, carbohydrates, phenol), (DNA samples only).
Example	1.91
Domain	Molecular Protocol ^c
Range	xsd:decimal

Original Date and Time ^dp

IRI	`http://ns.adobe.com/xap/1.0/CreateDate`
Is Defined By	http://ns.adobe.com/xap/1.0/
Description	The date of the creation of the original resource from which the digital media was derived or created. The date and time MUST comply with the World Wide Web Consortium (W3C) datetime practice, [https://www.w3.org/TR/NOTE-datetime], which requires that date and time representation correspond to ISO 8601:1998, but with year fields always comprising 4 digits. This makes datetime records compliant with 8601:2004, [https://www.iso.org/standard/40874.html]. [ac:] datetime values MAY also follow 8601:2004 for ranges by separating two IS0 8601 datetime fields by a solidus ("forward slash", '/'). When applied to a media resource with temporal extent such as audio or video, this property indicates the startTime of the recording. What constitutes "original" is determined by the metadata author. Example: Digitization of a photographic slide of a map would normally give the date at which the map was created; however a photographic work of art including the same map as its content may give the date of the original photographic exposure. Imprecise or unknown dates can be represented as ISO dates or ranges. Compare also Date and Time Digitized in the Resource Creation Vocabulary. See also the wikipedia IS0 8601 entry, [https://en.wikipedia.org/wiki/ISO_8601], for further explanation and examples. The date and time a resource was created. For a digital file, this need not match a file-system creation time. For a freshly created resource, it should be close to that time, modulo the time taken to write the file. Later file transfer, copying, and so on, can make the file-system time arbitrarily different.
Domain	Media ^c
Range	Literal

Creator (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/creator`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	Examples of a Creator include a person, an organization, or a service. Typically, the name of a Creator should be used to indicate the entity. An entity primarily responsible for making the resource.
Super Property Of	Creator ^dp

Format (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/format`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	Recommended practice is to use a controlled vocabulary where available. For example, for file formats one could use the list of Internet Media Types MIME. The file format, physical medium, or dimensions of the resource.

Language (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/language`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	Recommended practice is to use either a non-literal value representing a language from a controlled vocabulary such as ISO 639-2 or ISO 639-3, or a literal value consisting of an IETF Best Current Practice 47 IETF-BCP47 language tag. A language of the resource.

Rights (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/rights`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights Information about rights held in and over the resource.

Source (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/source`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	The described resource may be derived from the related resource in whole or in part. Recommended best practice is to identify the related resource by means of a string conforming to a formal identification system. A related resource from which the described resource is derived
Super Property Of	Assertion Type Source ^dp Assertion Value Source ^dp Survey Target Type Source ^dp

Title (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/title`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	A name given to the resource.

Type (DC) ^dp

IRI	`http://purl.org/dc/elements/1.1/type`
Is Defined By	http://purl.org/dc/elements/1.1/
Description	Recommended best practice is to use a controlled vocabulary such as the DCMI Type Vocabulary DCMI-TYPE. To describe the file format, physical medium, or dimensions of the resource, use the Format element. The nature or genre of the resource.

Bibliographic Citation ^dp

IRI	`http://purl.org/dc/terms/bibliographicCitation`
Is Defined By	DCMI Metadata Terms
Description	Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible. The intended usage of this term in Darwin core is to provide the preferred way to cite the resource itself. Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource, if one is available. A bibliographic reference for the resource.
Sub Property Of	Identifier ^dp
Range	Literal

Identifier ^dp

IRI	`http://purl.org/dc/terms/identifier`
Is Defined By	DCMI Metadata Terms
Description	Recommended practice is to identify the resource by means of a string conforming to an identification system. Examples include International Standard Book Number (ISBN), Digital Object Identifier (DOI), and Uniform Resource Name (URN). Persistent identifiers should be provided as HTTP URIs. An unambiguous reference to the resource within a given context.
Super Property Of	Bibliographic Citation ^dp Agent ID ^dp Assertion ID ^dp Derived From Media ID ^dp Event ID ^dp Geological Context ID ^dp Material Entity ID ^dp Media ID ^dp Molecular Protocol ID ^dp Nucleotide Analysis ID ^dp Nucleotide Sequence ID ^dp Occurrence ID ^dp Organism ID ^dp Organism Interaction ID ^dp Parent Event ID ^dp Parent Reference ID ^dp Protocol ID ^dp Reference ID ^dp Resource ID ^dp Resource Relationship ID ^dp Survey ID ^dp Survey Target ID ^dp Usage Policy ID ^dp
Range	Literal

Source (DCTERMS) ^dp

IRI	`http://purl.org/dc/terms/source`
Is Defined By	DCMI Metadata Terms
Description	This property is intended to be used with non-literal values. The described resource may be derived from the related resource in whole or in part. Best practice is to identify the related resource by means of a URI or string conforming to a formal identification system. A related resource from which the described resource is derived
Super Property Of	Survey Target Type Source IRI ^op
Domain	Thing ^c
Range	Thing ^c

Title ^dp

IRI	`http://purl.org/dc/terms/title`
Is Defined By	DCMI Metadata Terms
Description	Concise title, name, or brief descriptive label of institution, resource collection, or individual resource. This field SHOULD include the complete title with all the subtitles, if any. It is strongly suggested to provide a title. The title facilitates interactions with humans: e.g, it could be used as display text of hyperlinks or to provide a choice of images in a pick list. The title is therefore highly useful and an effort should be made to provide it where it is not already available. When the resource is a collection without an institutional or official name, but with a thematic content, a descriptive title, e.g. "Urban Ants of New England", would be suitable. In individual media resources depicting taxa, the scientific name or names of taxa are often a good title. Common names, in addition to or instead of scientific names are also acceptable. Indications of action or roles captured by the media resource, such as predatory acts, are desireable ("Rattlesnake eating deer mouse", "Pollinators of California Native Plants"). A name given to a resource.
Super Property Of	Preferred Agent Name ^dp Preferred Event Name ^dp Protocol ID ^dp
Range	Literal

Edition ^dp

IRI	`http://purl.org/ontology/bibo/edition`
Is Defined By	http://purl.org/ontology/bibo/
Description	The name defining a special edition of a document. Normally its a literal value composed of a version number and words.
Domain	Document (BIBO) ^c
Range	xsd:string

Issue ^dp

IRI	`http://purl.org/ontology/bibo/issue`
Is Defined By	http://purl.org/ontology/bibo/
Description	An issue number of a dcterms:BibliographicResource.
Domain	Document (BIBO) ^c
Range	xsd:string

Pages ^dp

IRI	`http://purl.org/ontology/bibo/pages`
Is Defined By	http://purl.org/ontology/bibo/
Description	A string of non-contiguous page spans that locate a bibo:Document within a bibo:Collection. Example: 23-25, 34, 54-56. For continuous page ranges, use the bibo:pageStart and bibo:pageEnd properties. A range of pages within a dcterms:BibliographicResource.
Example	23-25, 34, 54-56
Domain	Document (BIBO) ^c
Range	xsd:string

Volume ^dp

IRI	`http://purl.org/ontology/bibo/volume`
Is Defined By	http://purl.org/ontology/bibo/
Description	A volume number of a dcterms:BibliographicResource.
Domain	Document (BIBO) ^c
Range	xsd:string

Sample Rate ^dp

IRI	`http://purl.org/ontology/mo/sample_rate`
Is Defined By	http://purl.org/ontology/mo/
Description	Numeric valuein hertz (Hz). Forexample, a Service Access Point may have a specific resolution, quality or format. "Sample Rate" is distinct from the related concept of "bit rate" for compressed files such as MP#, and is applicable to both uncompressed and compressed files. see http://musicontology.com/specification/#term-sample_rate for additional information. Associates a digital signal to its sample rate.
Domain	Media ^c
Range	xsd:decimal

DNA Sequence ^dp

IRI	`http://rs.gbif.org/terms/dna_sequence`
Is Defined By	http://rs.gbif.org/terms/
Description	The DNA sequence.
Example	TCTATCCTCAATTATAGGTCATAATTCACCATCAGTAGATTTAGGAATTTTCTCTATTCATATTGCAGGTGTATCATCAATTATAGGATCAATTAATTTTATTGTAACAATTTTAAATATACATACAAAAACTCATTCATTAAACTTTTTACCATTATTTTCATGATCAGTTCTAGTTACAGCAATTCTCCTTTTATTATCATTA
Domain	Molecular Protocol ^c
Range	xsd:string

Amplicon Size ^dp

IRI	`http://rs.gbif.org/terms/miqe/ampliconSize`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	The length of the amplicon in basepairs.
Example	83
Domain	Molecular Protocol ^c
Range	xsd:integer

Annealing Phase Temperature ^dp

IRI	`http://rs.gbif.org/terms/miqe/annealingTemp`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	The reaction temperature during the annealing phase of PCR.
Example	60
Domain	Molecular Protocol ^c
Range	xsd:decimal

Annealing Phase Temperature Unit ^dp

IRI	`http://rs.gbif.org/terms/miqe/annealingTempUnit`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	Measurement Unit of the reaction temperature during the annealing phase of PCR.
Example	Degrees celsius
Domain	Molecular Protocol ^c
Range	Literal

Fluorescence Baseline Value ^dp

IRI	`http://rs.gbif.org/terms/miqe/baselineValue`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	The number of cycles when fluorescence signal from the target amplification is below background fluorescence not originated from the real target amplification.
Example	15
Domain	Molecular Protocol ^c
Range	xsd:integer

Probe Quencher ^dp

IRI	`http://rs.gbif.org/terms/miqe/probeQuencher`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	Type of quencher used. The quencher molecule quenches the fluorescence emitted by the fluorophore when excited by the cycler's light source. As long as fluorophore and the quencher are in proximity, quenching inhibits any fluorescence signals.
Example	NFQ-MGB
Domain	Molecular Protocol ^c
Range	Literal

Probe Reporter ^dp

IRI	`http://rs.gbif.org/terms/miqe/probeReporter`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	Type of fluorophore (reporter) used. Probe anneals within amplified target DNA. Polymerase activity degrades the probe that has annealed to the template, and the probe releases the fluorophore from it and breaks the proximity to the quencher, thus allowing fluorescence in the fluorophore.
Example	FAM
Domain	Molecular Protocol ^c
Range	Literal

Quantification Cycle Number ^dp

IRI	`http://rs.gbif.org/terms/miqe/quantificationCycle`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	The number of cycles required for the fluorescent signal to cross a given value threshold above the baseline. Quantification cycle (Cq), threshold cycle (Ct), crossing point (Cp), and take-off point (TOP) refer to the same value from the real-time instrument. Use of quantification cycle (Cq), is preferable according to the RDML (Real-Time PCR Data Markup Language) data standard ([http://www.rdml.org]).
Example	37.9450950622558
Domain	Molecular Protocol ^c
Range	xsd:decimal

Fluorescence Cycle Threshold ^dp

IRI	`http://rs.gbif.org/terms/miqe/thresholdQuantificationCycle`
Is Defined By	http://rs.gbif.org/terms/miqe/
Description	Threshold for change in fluorescence signal between cycles.
Example	0.3
Domain	Molecular Protocol ^c
Range	xsd:decimal

Forward PCR Primer ^dp

IRI	`http://rs.gbif.org/terms/pcr_primer_forward`
Is Defined By	http://rs.gbif.org/terms/
Description	Forward PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same [dwc:Occurrence]. The primer sequence should be reported in uppercase letters.
Example	GGACTACHVGGGTWTCTAAT
Domain	Molecular Protocol ^c
Range	xsd:string

Forward PCR Primer Name ^dp

IRI	`http://rs.gbif.org/terms/pcr_primer_name_forward`
Is Defined By	http://rs.gbif.org/terms/
Description	Name of the forward PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same [dwc:Occurrence].
Example	jgLCO1490
Domain	Molecular Protocol ^c
Range	Literal

Reverse PCR Primer Name ^dp

IRI	`http://rs.gbif.org/terms/pcr_primer_name_reverse`
Is Defined By	http://rs.gbif.org/terms/
Description	Name of the reverse PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same [dwc:Occurrence].
Example	jgHCO2198
Domain	Molecular Protocol ^c
Range	Literal

PCR Primer Reference ^dp

IRI	`http://rs.gbif.org/terms/pcr_primer_reference`
Is Defined By	http://rs.gbif.org/terms/
Description	Reference for the PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment.
Example	https:doi.org/10.11861742-9994-10-31
Domain	Molecular Protocol ^c
Range	xsd:anyURI ^c or Literal ^c

Reverse PCR Primer ^dp

IRI	`http://rs.gbif.org/terms/pcr_primer_reverse`
Is Defined By	http://rs.gbif.org/terms/
Description	Reverse PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same [dwc:Occurrence]. The primer sequence should be reported in uppercase letters.
Example	GGACTACHVGGGTWTCTAAT
Domain	Molecular Protocol ^c
Range	xsd:string

Caption ^dp

IRI	`http://rs.tdwg.org/ac/terms/caption`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	If both [dcterms:description] and [ac:caption] are present in the metadata, a [dcterms:description] is typically displayed instead of the resource, a [ac:caption] together with the resource. Thus, in HTML it would be appropriate to use [ac:caption] values in figcaption elements. Often only one of the [dcterms:description] or [ac:caption] is present; choose the term most appropriate for your metadata. Free-form text to be displayed together with (rather than instead of) a resource that is suitable for captions (especially images).
Domain	Media ^c
Range	Literal

Capture Device ^dp

IRI	`http://rs.tdwg.org/ac/terms/captureDevice`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	The sum of a valid value plus [ac:xFrac] MUST be greater than zero and less than or equal to one. The precision of this value SHOULD be great enough that when [ac:widthFrac] and [ac:xFrac] are used with the [exif:PixelXDimension] of the Best Quality variant of the Service Access point to calculate the lower right corner of the rectangle, rounding to the nearest integer results in the same horizontal pixel originally used to define the point. This term MUST NOT be used with [ac:radius] to define a region of interest. Zero-sized bounding rectangles are not allowed. To designate a point, use the radius option with a zero value. Free-form text describing the device or devices used to create the resource.
Example	Canon Supershot 2000 SEM (Scanning Electron Microscope) Zeiss Axioscope with Camera Illu
Domain	Media ^c
Range	xsd:string

Digitization Date ^dp

IRI	`http://rs.tdwg.org/ac/terms/digitizationDate`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	The date and time MUST comply with the World Wide Web Consortium (W3C) datetime practice, https://www.w3.org/TR/NOTE-datetime, which requires that date and time representation correspond to ISO 8601:1998, but with year fields always comprising 4 digits.This makes datetime records compliant with 8601:2004, https://www.iso.org/standard/40874.html. AC datetime values MAY also follow 8601:2004 for ranges by separating the ISO 8601 fields by a solidus ("forward slash", '/'). Use the international (ISO/xml) format yyyy-mm-ddThh:mm. Where available, timezone information SHOULD be added. Date the first digital version was created, if different from Original Date found in the Temporal Coverage Vocabulary.
Example	2007-12-31 2007-12-31T14:59
Domain	Media ^c
Range	xsd:string

End Time in Seconds ^dp

IRI	`http://rs.tdwg.org/ac/terms/endTime`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This term MUST be applied to a region of interest. The end of a temporal region, as specified as an absolute offset relative to the beginning of a ac:Media resource (this corresponds to Normal Play Time RFC 2326), specified as seconds, with an optional fractional part to indicate milliseconds or finer.
Domain	Media ^c
Range	xsd:decimal

End Time Stamp ^dp

IRI	`http://rs.tdwg.org/ac/terms/endTimestamp`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This term MAY be applied to a region of interest or an entire media item. The end of a temporal region, specified as real-world clock time ISO 8601 timestamps, using UTC timezone, with an optional fractional part to indicate milliseconds or finer. There is no limit on the number of decimal places for the decimal fraction.
Domain	Media ^c
Range	xsd:string

Frame Rate ^dp

IRI	`http://rs.tdwg.org/ac/terms/frameRate`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This term representsthe rate at which consecutive images were captured in real time, not the rate at which the media is encoded to play back the recording. For example, in a recording where 60 consecutive images (frames) are captured for each second of the real-time recording, this would be `60`. In a time-lapse recording where one image (frame) is recorded every 5 seconds of recording, this would be `0.2`. The decimal fraction representing the frequency (rate) at which consecutive images (frames) were captured in real time for a [dcmi:MovingImage], expressed as the number of frames per second.
Example	0.2 60
Domain	Media ^c
Range	xsd:decimal

Upper Frequency Bound ^dp

IRI	`http://rs.tdwg.org/ac/terms/freqHigh`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Numeric value in hertz (Hz). This term refers to the sound events depicted and not to the constraints of the recording medium, so are in principle independent from sampleRate. If [dwc:scientificName] is specified and if applied to the entire multimedia item, these frequency bounds refer to the sounds of the species given in the [dwc:scientificName] throughout the whole recording. Although many users will specify both [ac:freqLow] and [ac:freqHigh], it is permitted to specify just one or the other, for example if only one of the bounds is discernible. The highest frequency of the phenomena reflected in the multimedia item or Region of Interest.
Example	60
Domain	Media ^c
Range	xsd:decimal

Lower Frequency Bound ^dp

IRI	`http://rs.tdwg.org/ac/terms/freqLow`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Numeric value in hertz (Hz). This term refers to the sound events depicted and not to the constraints of the recording medium, so are in principle independent from sampleRate. If [dwc:scientificName] is specified and if applied to the entire multimedia item, these frequency bounds refer to the sounds of the species given in the [dwc:scientificName] throughout the whole recording. Although many users will specify both [ac:freqLow] and [ac:freqHigh], it is permitted to specify just one or the other, for example if only one of the bounds is discernible. The lowest frequency of the phenomena reflected in the multimedia item or Region of Interest.
Example	60
Domain	Media ^c
Range	xsd:decimal

Funding Attribution ^dp

IRI	`http://rs.tdwg.org/ac/terms/fundingAttribution`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., `NSF` for the `National Science Foundation`). Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). A list (concatenated and separated) of names of the funding organizations or agencies that provided funding for a project.
Example	Artsdatabanken National Science Foundation Norges forskningsråd Ocean Census \| Nippon Foundation
Domain	Provenance ^c
Range	xsd:string

Funding Attribution ID ^dp

IRI	`http://rs.tdwg.org/ac/terms/fundingAttributionID`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). An identifier for a dcterms:Agent that financially supported a project.
Example	https://ror.org/00epmv149 https://ror.org/00epmv149 \| https://ror.org/04jnzhb65 https://www.wikidata.org/wiki/Q13102615
Domain	Provenance ^c
Range	xsd:string

Hash Function ^dp

IRI	`http://rs.tdwg.org/ac/terms/hashFunction`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Recommended values include MD5, SHA-1, SHA-224, SHA-256, SHA-385, SHA-512, SHA-512/224 and SHA-512/256. The cryptographic hash function used to compute the value given in the [ac:hashValue].
Domain	Media ^c
Range	xsd:string

Hash ^dp

IRI	`http://rs.tdwg.org/ac/terms/hashValue`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Best practice is to also specify the hash function by supplying a value of the [ac:hashFunction] term, using one of the standard literals from the comments there. The value computedby by a hash function applied to the media that will be delivered at the access point.
Domain	Media ^c
Range	xsd:string

Fractional Height ^dp

IRI	`http://rs.tdwg.org/ac/terms/heightFrac`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	The sum of a valid value plus [ac:yFrac] MUST be greater than zero and less than or equal to one. The precision of this value SHOULD be great enough that when [ac:heightFrac] and [ac:yFrac] are used with the [exif:PixelYDimension] of the Best Quality variant of the Service Access point to calculate the lower right corner of the rectangle, rounding to the nearest integer results in the same vertical pixel originally used to define the point. This term MUST NOT be used with [ac:radius] to define a region of interest. Zero-sized bounding rectangles are not allowed. To designate a point, use the radius option with a zero value. The height of the bounding rectangle, expressed as a decimal fraction of the height of a [dwc:Media] resource.
Example	0.5 1
Domain	Media ^c
Range	xsd:decimal

Is Part Of Media ID ^dp

IRI	`http://rs.tdwg.org/ac/terms/isROIOf`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This term can be used to define an [ac:RegionOfInterest] within an [ac:Media] resource. Recommended best practice is to use a globally unique identifier. An identifier for an [ac:Media] resource of which this [ac:Media] resource is a part.
Domain	Media ^c
Range	Literal

Media Duration ^dp

IRI	`http://rs.tdwg.org/ac/terms/mediaDuration`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This might be different from the time in seconds calculated as the difference of ac:endTimestamp and ac:startTimestamp if ac:mediaSpeed is not equal to `1`. The playback duration of an audio or video file in seconds.
Domain	Media ^c
Range	xsd:decimal

Media Speed ^dp

IRI	`http://rs.tdwg.org/ac/terms/mediaSpeed`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	If a value for ac:mediaSpeed is not provided, applications SHOULD assume that 1.0 is the value. For example, in a time-lapse recording where 60 seconds of natural time is represented in 1 second of media this would be `60`. In a time-expanded recording where 1 second of recording is represented in 5 seconds of media, this would be `0.2`. The decimal fraction representing the natural speed over the encoded speed.
Example	0.2 60
Domain	Media ^c
Range	xsd:decimal

Radius ^dp

IRI	`http://rs.tdwg.org/ac/terms/radius`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	A valid value MUST be greater than or equal to zero. A valid value MAY cause the designated circle to extend beyond the bounds of a [dwc:Media] resource. In that case, the arc within a [dwc:Media] resource plus the bounds of a [dwc:Media] resource specify the region of interest. This term MUST NOT be used with [ac:widthFrac] or [ac:heightFrac] to define a region of interest. This term may be used with [ac:xFrac] and [ac:yFrac] to define a point. In that case, the implication is that the point falls on some object of interest within a [dwc:Media] resource, but nothing more can be assumed about the bounds of that object. The radius of a bounding circle or arc, expressed as a fraction of the width of a [dwc:Media] resource.
Example	100
Domain	Media ^c
Range	xsd:integer

Resource Creation Technique ^dp

IRI	`http://rs.tdwg.org/ac/terms/resourceCreationTechnique`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Annotating whether and how a resource has been modified or edited significantly in ways that are not immediately obvious to, or expected by, consumers is of special significance. Examples for images are: Removing a distracting twig from a picture, moving an object to a different surrounding, changing the color in parts of the image, or blurring the background of an image. Modification that are standard practice and expected or obvious are not necessary to document; examples of such practices include changing resolution, cropping, minor sharpening or overall color correction, and clearly perceptible modifications (e.g. addition of arrows or the placement of multiple pictures into a table). If it is only known that significant modifications were made but no details are known, a general statement like "Media may have been manipulated to improve appearance" may be appropriate. See also Subject Preparation Techniques (dwc:preparations). Information about technical aspects of the creation and digitization process of the resource. This includes modification steps ("retouching") after the initial resource capture.
Example	2007-12-31 2007-12-31T14:59
Domain	Media ^c
Range	xsd:string

Start Time in Seconds ^dp

IRI	`http://rs.tdwg.org/ac/terms/startTime`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This term MUST be applied to a region of interest. The beginning of a temporal region, as specified as an absolute offset relative to the beginning of a ac:Media resource (this corresponds to Normal Play Time RFC 2326), specified as seconds, with an optional fractional part to indicate milliseconds or finer.
Domain	Media ^c
Range	xsd:decimal

Start Time Stamp ^dp

IRI	`http://rs.tdwg.org/ac/terms/startTimestamp`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	This term MAY be applied to a region of interest or an entire media item. The beginning of a temporal region, specified as real-world clock time ISO 8601 timestamps, using UTC timezone, with an optional fractional part to indicate milliseconds or finer. There is no limit on the number of decimal places for the decimal fraction.
Domain	Media ^c
Range	xsd:string

Subject Orientation ^dp

IRI	`http://rs.tdwg.org/ac/terms/subjectOrientationIRI`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Values SHOULD be selected from the Controlled Vocabulary for Audiovisual Core subjectOrientation. In text-based systems such as tables, IRI values MUST be in unabbreviated form. Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device, denoted by an IRI.
Domain	Media ^c
Range	xsd:anyURI

Subject Orientation Literal ^dp

IRI	`http://rs.tdwg.org/ac/terms/subjectOrientationLiteral`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Values SHOULD be selected fom the Controlled Vocabulary for ac:subjectOrientation. It is best practice to use ac:subjectOrientationLiteral whenever practical. Specific orientation (= direction view angle) of the subject represented in the ac:Media resource with respect to the acquisition device, denoted by a controlled value string.
Example	anterior apical basal oral
Domain	Media ^c
Range

Subject Part ^dp

IRI	`http://rs.tdwg.org/ac/terms/subjectPartIRI`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Values SHOULD be selected from the Controlled Vocabulary for Audiovisual Core subjectPart. In text-based systems such as tables, IRI values MUST be in unabbreviated form. The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the ac:Media resource, denoted by an IRI.
Domain	Media ^c
Range	xsd:anyURI

Subject Part Literal ^dp

IRI	`http://rs.tdwg.org/ac/terms/subjectPartLiteral`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Values SHOULD be selected fom the Controlled Vocabulary for ac:subjectPart. It is best practice to use ac:subjectPartLiteral whenever practical. The portion or product of organism morphology, behaviour, environment, etc. that is eithre predominently shown or particularly well exemplified by the ac:Media resource, denoted by a controlled value string.
Example	entireOrganism fin flower
Domain	Media ^c
Range

Subtype Literal ^dp

IRI	`http://rs.tdwg.org/ac/terms/subtypeLiteral`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	The [ac:subtypeLiteral] term MUST NOT be applied to Collection objects. However, the Description term in the Content Coverage Vocabulary might add further description to a Collection object. Controlled string values SHOULD be selected from the Controlled Vocabulary for [ac:subtype]. Human-readable information about the Controlled Vocabulary for [ac:subtype] is at [http://rs.tdwg.org/ac/doc/subtype/]. It is best practice to use [ac:subtype] instead of [ac:subytpeLiteral] whenever practical. A subcategory that allows further specialization of a [dwc:Media] resource type than [mediaType].
Domain	Media ^c
Range	Literal

Time Of Day ^dp

IRI	`http://rs.tdwg.org/ac/terms/timeOfDay`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	Free text information beyond exact clock times.
Example	afternoon twilight
Domain	Media ^c
Range	xsd:string

Fractional Width ^dp

IRI	`http://rs.tdwg.org/ac/terms/widthFrac`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	The sum of a valid value plus [ac:xFrac] MUST be greater than zero and less than or equal to one. The precision of this value SHOULD be great enough that when [ac:widthFrac] and [ac:xFrac] are used with the [exif:PixelXDimension] of the Best Quality variant of the Service Access point to calculate the lower right corner of the rectangle, rounding to the nearest integer results in the same horizontal pixel originally used to define the point. This term MUST NOT be used with [ac:radius] to define a region of interest. Zero-sized bounding rectangles are not allowed. To designate a point, use the radius option with a zero value. The width of the bounding rectangle, expressed as a decimal fraction of the width of a [dwc:Media] resource.
Example	0.5 1
Domain	Media ^c
Range	xsd:decimal

Fractional X ^dp

IRI	`http://rs.tdwg.org/ac/terms/xFrac`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	A valid value MUST be greater than or equal to zero and less than or equal to one. The precision of this value SHOULD be great enough that when the [ac:xFrac] value is multiplied by the [exif:PixelXDimension] of the Best Quality variant of the Service Access point, rounding to the nearest integer results in the same horizontal pixel location originally used to define the point. This point can serve as the horizontal position of the upper left corner of a bounding rectangle, or as the center of a circle. The horizontal position of a reference point, measured from the left side of a [dwc:Media] resource and expressed as a decimal fraction of the width of a [dwc:Media] resource.
Example	0.5 1
Domain	Media ^c
Range	xsd:decimal

Fractional Y ^dp

IRI	`http://rs.tdwg.org/ac/terms/yFrac`
Is Defined By	http://rs.tdwg.org/ac/terms/
Description	A valid value MUST be greater than or equal to zero and less than or equal to one. The precision of this value SHOULD be great enough that when the [ac:yFrac] value is multiplied by the [exif:PixelYDimension] of the Best Quality variant of the Service Access point, rounding to the nearest integer results in the same vertical pixel originally used to define the point. This point can serve as the vertical position of the upper left corner of a bounding rectangle, or as the center of a circle. The vertical position of a reference point, measured from the top of a [dwc:Media] resource and expressed as a decimal fraction of the height of a [dwc:Media] resource.
Example	0.5 1
Domain	Media ^c
Range	xsd:decimal

Agent ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/agentID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dcterms:Agent].
Sub Property Of	Identifier ^dp
Domain	Agent ^c
Range	Literal

Agent Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/agentRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about a [dcterms:Agent].
Domain	Agent ^c
Range	Literal

Agent Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/agentType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. A category that best matches the nature of a [dcterms:Agent].
Example	camera group organization person
Domain	Agent ^c
Range	Literal

Assay Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assayType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. A method used in the study to detect taxon/taxa of interest in the sample
Example	metabarcoding other targeted
Domain	Molecular Protocol ^c
Range	Literal

Assertion Effective Date ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionEffectiveDate`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. A date on which a state or measurement of a [dwc:Assertion] was deemed to first be in effect.
Example	1809-02-12 1900/1909 1906-06 1963-04-08T14:07-06:00 1971 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z 2007-11-13/15 2009-02-20T08:40Z 2018-08-29T15:19
Domain	Assertion ^c
Range	Literal

Assertion ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:Assertion].
Sub Property Of	Identifier ^dp
Domain	Assertion ^c
Range	Literal

Assertion Made Date ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionMadeDate`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. A date on which a [dwc:Assertion] was created.
Example	1809-02-12 1900/1909 1906-06 1963-04-08T14:07-06:00 1971 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z 2007-11-13/15 2009-02-20T08:40Z 2018-08-29T15:19
Domain	Assertion ^c
Range	Literal

Assertion Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the [dwciri:] namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A category that best matches the nature of a [dwc:Assertion].
Example	survey area tail length temperature trap line length trap type
Domain	Assertion ^c
Range	Literal

Assertion Type Source ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionTypeSource`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A reference to the controlled vocabulary in which the definition of a value in [dwc:assertionType] is given.
Sub Property Of	Source (DC) ^dp
Domain	Assertion ^c
Range	Literal

Assertion Value ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionValue`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An asserted value, if it is not numeric.
Domain	Assertion ^c
Range	Literal

Assertion Value Numeric ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionValueNumeric`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An asserted value, if it is numeric.
Domain	Assertion ^c
Range	xsd:decimal

Assertion Value Source ^dp

IRI	`http://rs.tdwg.org/dwc/terms/assertionValueSource`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A reference to a controlled vocabulary in which the definition of a value in [dwc:assertionValue] is given.
Sub Property Of	Source (DC) ^dp
Domain	Assertion ^c
Range	Literal

Bed ^dp

IRI	`http://rs.tdwg.org/dwc/terms/bed`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the lithostratigraphic bed from which the [dwc:MaterialEntity] was collected.
Example	Harlem coal
Domain	Geological Context ^c
Range	Literal

Behavior ^dp

IRI	`http://rs.tdwg.org/dwc/terms/behavior`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The behavior shown by the subject at the time the [dwc:Occurrence] was recorded.
Example	foraging roosting running
Domain	Occurrence Assertion ^c
Range	xsd:string

Caste ^dp

IRI	`http://rs.tdwg.org/dwc/terms/caste`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary that aligns best with the dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. Categorisation of individuals for eusocial species (including some mammals and arthropods).
Example	ergatoid intercaste male alate minor worker queen soldier
Domain	Occurrence Assertion ^c or Material Entity Assertion ^c
Range	xsd:string

Cause Of Death ^dp

IRI	`http://rs.tdwg.org/dwc/terms/causeOfDeath`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The cause may be due to natural causes (e.g., `disease`, `predation`), human-related activities (e.g., `roadkill`, `pollution`), or other environmental factors (e.g., `extreme weather events`). An indication of the known or suspected cause of death of a dwc:Organism.
Example	burned disease drowned herbicide` infanticide old age poisoned roadkill shot starved trapped
Domain	Occurrence ^c or Organism ^c
Range	xsd:string

Continent ^dp

IRI	`http://rs.tdwg.org/dwc/terms/continent`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. The name of the continent in which the dcterms:Location occurs.
Example	Africa Antarctica Asia Europe North America Oceania South America
Domain	Location ^c
Range	xsd:string

Coordinate Precision ^dp

IRI	`http://rs.tdwg.org/dwc/terms/coordinatePrecision`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A decimal representation of the precision of the coordinates given in the dwc:decimalLatitude and dwc:decimalLongitude.
Example	0.00001 0.000278 0.01667 1.0
Domain	Location ^c
Range	xsd:decimal

Coordinate Uncertainty In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The horizontal distance (in meters) from the given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
Example	30 71 100
Domain	Location ^c
Range	xsd:decimal

Country ^dp

IRI	`http://rs.tdwg.org/dwc/terms/country`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. The name of the country or major administrative unit in which the dcterms:Location occurs.
Example	Colombia Denmark España
Domain	Location ^c
Range	xsd:string

Country Code ^dp

IRI	`http://rs.tdwg.org/dwc/terms/countryCode`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or `ZZ` (for an unknown location or a location unassignable to a single country code), or `XZ` (for the high seas beyond national jurisdictions). The standard code for the country in which the dcterms:Location occurs.
Example	AR SV XZ ZZ
Domain	Location ^c
Range	xsd:string

Creator ^dp

IRI	`http://rs.tdwg.org/dwc/terms/creatorLiteral`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Human readable, or doi number, or URL. Simple name of parent for human readable. A name of a dcterms:Agent primarily responsible for making the resource.
Sub Property Of	Creator (DC) ^dp
Domain	Provenance ^c
Range	langString

Dataset ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/datasetID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a dataset from which data originated.
Example	b15d4952-7d20-46f1-8a3e-556a512b04c5
Domain	Provenance ^c
Range	xsd:string

Day ^dp

IRI	`http://rs.tdwg.org/dwc/terms/day`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The integer day of the month on which the dwc:Event occurred.
Example	9 28
Domain	Event ^c
Range	xsd:integer

Decimal Latitude ^dp

IRI	`http://rs.tdwg.org/dwc/terms/decimalLatitude`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of the geographic center of a dcterms:Location. Positive values are north of the Equator, negative values are south of it. Legal values lie between `-90` and `90`, inclusive.
Example	-41.0983423
Domain	Location ^c
Range	xsd:decimal

Decimal Longitude ^dp

IRI	`http://rs.tdwg.org/dwc/terms/decimalLongitude`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of the geographic center of a dcterms:Location. Positive values are east of the Greenwich Meridian, negative values are west of it. Legal values lie between `-180` and `180`, inclusive.
Example	-41.0983423
Domain	Location ^c
Range	xsd:decimal

Degree of Establishment ^dp

IRI	`http://rs.tdwg.org/dwc/terms/degreeOfEstablishment`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Example	captive casual colonising cultivated established failing invasive native released reproducing widespreadInvasive
Domain	Occurrence ^c
Range

Derived From Media ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/derivedFromMediaID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term can be used when an [ac:Media] resource has been separated from its source [ac:Media] resource. Recommended best practice is to use a globally unique identifier. An identifier for an [ac:Media] resource of which this [ac:Media] resource is a part.
Sub Property Of	Identifier ^dp
Domain	Media ^c
Range	Literal

Disposition ^dp

IRI	`http://rs.tdwg.org/dwc/terms/disposition`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A current state of a dwc:MaterialEntity with respect to where it can be found.
Example	deaccessioned destroyed in collection missing on loan used up
Domain	Material Entity ^c
Range	Literal

Earliest Age Or Lowest Stage ^dp

IRI	`http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Example	Atlantic Boreal Skullrockian
Domain	Geological Context ^c
Range	Literal

Earliest Eon Or Lowest Eonothem ^dp

IRI	`http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name (`Precambrian`) attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Phanerozoic Proterozoic
Domain	Geological Context ^c
Range	Literal

Earliest Epoch Or Lowest Series ^dp

IRI	`http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Holocene Ibexian Series Pleistocene
Domain	Geological Context ^c
Range	Literal

Earliest Era Or Lowest Erathem ^dp

IRI	`http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Cenozoic Mesozoic
Domain	Geological Context ^c
Range	Literal

Earliest Period Or Lowest System ^dp

IRI	`http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Neogene Quaternary Tertiary
Domain	Geological Context ^c
Range	Literal

End Day Of Year ^dp

IRI	`http://rs.tdwg.org/dwc/terms/endDayOfYear`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The value is `1` for January 1 and `365` for December 31, except in a leap year, in which case it is `366`. The latest integer day of the year on which a dwc:Event occurred.
Example	1 32 365 366
Domain	Event ^c
Range

Establishment Means ^dp

IRI	`http://rs.tdwg.org/dwc/terms/establishmentMeans`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Example	introduced introducedAssistedColonisation native nativeEndemic nativeReintroduced uncertain vagrant
Domain	Occurrence ^c
Range

Event Category ^dp

IRI	`http://rs.tdwg.org/dwc/terms/eventCategory`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a limited, tightly controlled vocabulary. A broad category tat best matches the nature of a [dwc:Event].
Example	material gathering nucleotide analysis occurrence organism interaction survey varied
Domain	Event ^c
Range	Literal

Event Date ^dp

IRI	`http://rs.tdwg.org/dwc/terms/eventDate`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. The date-time or interval during which a dwc:Event occurred. For occurrences, this is the date-time when the dwc:Event was recorded. Not suitable for a time in a geological context.
Example	1809-02-12 1900/1909 1906-06 1963-04-08T14:07-06:00 1971 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z 2007-11-13/15 2009-02-20T08:40Z 2018-08-29T15:19
Domain	Event ^c
Range	xsd:string ^c or xsd:dateTime ^c

Event ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/eventID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:Event].
Example	INBO:VIS:Ev:00009375
Sub Property Of	Identifier ^dp
Domain	Event ^c
Range	Literal

Event Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/eventRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. Comments or notes about the dwc:Event.
Example	After the recent rains the river is nearly at flood stage.
Domain	Event ^c
Range	langString

Event Time ^dp

IRI	`http://rs.tdwg.org/dwc/terms/eventTime`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019. The time or interval during which a dwc:Event occurred.
Example	08:40:21Z 13:00:00Z/15:30:00Z 14:07-06:00
Domain	Event ^c
Range	xsd:string

Event Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/eventType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A narrow category that best matches the nature of a dwc:Event.
Example	BioBlitz camera trap deployment expedition project site visit trawl
Domain	Event ^c
Range	langString

Field Notes ^dp

IRI	`http://rs.tdwg.org/dwc/terms/fieldNotes`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Example	Notes available in the Grinnell-Miller Library.
Domain	Event ^c
Range	xsd:anyURI

Field Number ^dp

IRI	`http://rs.tdwg.org/dwc/terms/fieldNumber`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. An identifier given to the dwc:Event in the field. Often serves as a link between field notes and the dwc:Event.
Example	RV Sol 87-03-08
Domain	Event ^c
Range	xsd:string

Footprint SRS ^dp

IRI	`http://rs.tdwg.org/dwc/terms/footprintSRS`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of the dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use the dwc:geodeticDatum and dwc:verbatimSRS instead. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Example	EPSG:4326 GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]] not recorded
Domain	Location ^c
Range	xsd:string

Footprint WKT ^dp

IRI	`http://rs.tdwg.org/dwc/terms/footprintWKT`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Example	POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20))
Domain	Location ^c
Range	xsd:string

Formation ^dp

IRI	`http://rs.tdwg.org/dwc/terms/formation`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the lithostratigraphic formation from which the [dwc:MaterialEntity] was collected.
Example	Fillmore Formation House Limestone Notch Peak Formation
Domain	Geological Context ^c
Range	Literal

Geodetic Datum ^dp

IRI	`http://rs.tdwg.org/dwc/terms/geodeticDatum`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for a string literal value. The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Example	Campo Inchauspe Clarke 1866 EPSG:4326 European 1950 NAD27 WGS84 not recorded
Domain	Location ^c
Range	xsd:string

Geological Context ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/geologicalContextID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:GeologicalContext].
Example	https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9
Sub Property Of	Identifier ^dp
Domain	Geological Context ^c
Range	Literal

Georeference Protocol ^dp

IRI	`http://rs.tdwg.org/dwc/terms/georeferenceProtocol`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A description or reference to the methods used to determine the spatial footprint, coordinates, and uncertainties.
Example	Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)
Domain	Location ^c
Range	xsd:string

Georeference Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/georeferenceRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about the spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol.
Example	Assumed distance by road (Hwy. 101)
Domain	Location ^c
Range	xsd:string

Georeference Sources ^dp

IRI	`http://rs.tdwg.org/dwc/terms/georeferenceSources`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference the dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Example	https://www.geonames.org/ GeoLocate USGS 1:24000 Florence Montana Quad 1967 \| Terrametrics 2008 on Google Earth
Domain	Location ^c
Range	xsd:string ^c or xsd:anyURI ^c

Georeference Verification Status ^dp

IRI	`http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Example	requires georeference requires verification unable to georeference verified by contributor verified by data custodian
Domain	Location ^c
Range	xsd:string

Georeferenced By ^dp

IRI	`http://rs.tdwg.org/dwc/terms/georeferencedBy`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A list (concatenated and separated) of names of people, groups, or organizations who determined the georeference (spatial representation) for the dcterms:Location.
Example	Brad Millen (ROM) Kristina Yamamoto \| Janet Fang
Domain	Location ^c
Range	xsd:string

Georeferenced Date ^dp

IRI	`http://rs.tdwg.org/dwc/terms/georeferencedDate`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. The date on which the dcterms:Location was georeferenced.
Example	1809-02-12 1900/1909 1906-06 1963-04-08T14:07-06:00 1971 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z 2007-11-13/15 2009-02-20T08:40Z 2018-08-29T15:19
Domain	Location ^c
Range	xsd:string

Group ^dp

IRI	`http://rs.tdwg.org/dwc/terms/group`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the lithostratigraphic group from which the [dwc:MaterialEntity] was collected.
Example	Bathurst Lower Wealden
Domain	Geological Context ^c
Range	Literal

Habitat ^dp

IRI	`http://rs.tdwg.org/dwc/terms/habitat`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A category or description of the habitat in which the dwc:Event occurred.
Example	oak savanna pre-cordilleran steppe
Domain	Event ^c
Range	langString

Higher Geography ^dp

IRI	`http://rs.tdwg.org/dwc/terms/higherGeography`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to separate the values in a list with space vertical bar space (`\|`), with terms in order from least specific to most specific. A list (concatenated and separated) of geographic names less specific than the information captured in the dwc:locality term.
Example	North Atlantic Ocean South America \| Argentina \| Patagonia \| Parque Nacional Nahuel Huapi \| Neuquén \| Los Lagos
Domain	Location ^c
Range	xsd:string

Higher Geography ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/higherGeographyID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a persistent identifier from a controlled vocabulary such as the Getty Thesaurus of Geographic Names. An identifier for the geographic region within which the dcterms:Location occurred.
Example	http://vocab.getty.edu/tgn/1002002
Domain	Location ^c
Range	xsd:string ^c or xsd:anyURI ^c

Highest Biostratigraphic Zone ^dp

IRI	`http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the highest possible geological biostratigraphic zone of the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Blancan
Domain	Geological Context ^c
Range	Literal

Identification ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/identificationID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a dwc:Identification.
Example	9992
Domain	Identification ^c
Range	xsd:string

Island ^dp

IRI	`http://rs.tdwg.org/dwc/terms/island`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. The name of the island on or near which the dcterms:Location occurs.
Example	Bikini Atoll Nosy Be Vancouver Viti Levu Zanzibar
Domain	Location ^c
Range	xsd:string

Island Group ^dp

IRI	`http://rs.tdwg.org/dwc/terms/islandGroup`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. The name of the island group in which the dcterms:Location occurs.
Example	Alexander Archipelago Archipiélago Diego Ramírez Seychelles
Domain	Location ^c
Range	xsd:string

Latest Age Or Highest Stage ^dp

IRI	`http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Atlantic Boreal Skullrockian
Domain	Geological Context ^c
Range	Literal

Latest Eon Or Highest Eonothem ^dp

IRI	`http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name (`Precambrian`) attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Phanerozoic Proterozoic
Domain	Geological Context ^c
Range	Literal

Latest Epoch Or Highest Series ^dp

IRI	`http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Holocene Ibexian Series Pleistocene
Domain	Geological Context ^c
Range	Literal

Latest Era Or Highest Erathem ^dp

IRI	`http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Cenozoic Mesozoic
Domain	Geological Context ^c
Range	Literal

Latest Period Or Highest System ^dp

IRI	`http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Neogene Quaternary Tertiary
Domain	Geological Context ^c
Range	Literal

Lithostratigraphic Terms ^dp

IRI	`http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The combination of all lithostratigraphic names for the rock from which the [dwc:MaterialEntity] was collected.
Example	Pleistocene-Weichselien
Domain	Geological Context ^c
Range	Literal

Locality ^dp

IRI	`http://rs.tdwg.org/dwc/terms/locality`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Less specific geographic information can be provided in other geographic terms (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description. The specific description of the place.
Example	Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237) Queets Rainforest, Olympic National Park
Domain	Location ^c
Range	langString

Location According To ^dp

IRI	`http://rs.tdwg.org/dwc/terms/locationAccordingTo`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Example	GADM Getty Thesaurus of Geographic Names
Domain	Location ^c
Range	langString

Location Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/locationRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about the dcterms:Location.
Example	under water since 2005
Domain	Location ^c
Range	langString

Lowest Biostratigraphic Zone ^dp

IRI	`http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the lowest possible geological biostratigraphic zone of the stratigraphic horizon from which the [dwc:MaterialEntity] was collected.
Example	Maastrichtian
Domain	Geological Context ^c
Range	Literal

Material Entity ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/materialEntityID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Values of [dwc:materialEntityID] are intended to uniquely and persistently identify a particular [dwc:MaterialEntity] within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a [dwc:MaterialEntity]) as opposed to a particular digital record (representation) of that physical object. An identifier for a [dwc:MaterialEntity].
Example	06809dc5-f143-459a-be1a-6f03e63fc083
Sub Property Of	Identifier ^dp
Domain	Material Entity ^c
Range	Literal

Maximum Depth In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/maximumDepthInMeters`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The greater depth of a range of depth below the local surface, in meters.
Example	0 200
Domain	Location ^c
Range

Maximum Distance Above Surface In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Example	-1.5 4.2
Domain	Location ^c
Range	xsd:decimal

Maximum Elevation In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/maximumElevationInMeters`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The upper limit of the range of elevation (altitude, usually above sea level), in meters.
Example	-205 1236
Domain	Location ^c
Range

Media ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/mediaID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for an [ac:Media] resource.
Sub Property Of	Identifier ^dp
Domain	Media ^c
Range	Literal

Member ^dp

IRI	`http://rs.tdwg.org/dwc/terms/member`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The full name of the lithostratigraphic member from which the [dwc:MaterialEntity] was collected.
Example	Hellnmaria Member Lava Dam Member
Domain	Geological Context ^c
Range	Literal

Minimum Depth In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/minimumDepthInMeters`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The lesser depth of a range of depth below the local surface, in meters.
Example	0 100
Domain	Location ^c
Range

Minimum Distance Above Surface In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeterss`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Example	-1.5 4.2
Domain	Location ^c
Range	xsd:decimal

Minimum Elevation In Meters ^dp

IRI	`http://rs.tdwg.org/dwc/terms/minimumElevationInMeters`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The lower limit of the range of elevation (altitude, usually above sea level), in meters.
Example	-100 802
Domain	Location ^c
Range

Molecular Protocol ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/molecularProtocolID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:MolecularProtocol].
Sub Property Of	Identifier ^dp
Domain	Molecular Protocol ^c
Range	xsd:string

Month ^dp

IRI	`http://rs.tdwg.org/dwc/terms/month`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The integer month in which the dwc:Event occurred.
Example	1 10
Domain	Event ^c
Range	xsd:integer

Third Order Division ^dp

IRI	`http://rs.tdwg.org/dwc/terms/municipality`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. The full, unabbreviated name of the next smaller administrative region than county (city, municipality, etc.) in which the dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual dcterms:Location.
Example	Araçatuba Ga-Segonyana Holzminden
Domain	Location ^c
Range	Literal

Nucleotide Analysis ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/nucleotideAnalysisID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:NucleotideAnalysis].
Sub Property Of	Identifier ^dp
Domain	Nucleotide Analysis ^c
Range	Literal

Nucleotide Sequence ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/nucleotideSequenceID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:NucleotideSequence].
Sub Property Of	Identifier ^dp
Domain	Nucleotide Sequence ^c
Range	xsd:string

Nucleotide Sequence Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about a [dwc:NucleotideSequence].
Domain	Nucleotide Sequence ^c
Range	Literal

Object Quantity ^dp

IRI	`http://rs.tdwg.org/dwc/terms/objectQuantity`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An dwc:objectQuantity must have a corresponding dwc:objectQuantityType. A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Example	27 many
Domain	Material Entity ^c
Range	xsd:string ^c or xsd:integer ^c

Object Quantity Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/objectQuantityType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. The type of quantification system used for the quantity of dwc:MaterialEntities.
Example	individuals
Domain	Material Entity ^c
Range	Literal

Occurrence ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/occurrenceID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a persistent, globally unique identifier. An identifier for the dwc:Occurrence (as opposed to a particular digital record of the dwc:Occurrence). In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
Example	http://arctos.database.museum/guid/MSB:Mamm:233627 urn:catalog:UWBM:Bird:89776 000866d2-c177-4648-a200-ead4007051b9
Sub Property Of	Identifier ^dp
Domain	Occurrence ^c
Range	xsd:string ^c or xsd:anyURI ^c

Occurrence Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/occurrenceRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about the dwc:Occurrence.
Example	found dead on road
Domain	Occurrence ^c
Range	Literal

Occurrence Status ^dp

IRI	`http://rs.tdwg.org/dwc/terms/occurrenceStatus`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	For dwc:Occurrences, the default vocabulary is recommended to consist of `detected` and `notDetected`, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A statement about the detection or non-detection of a dwc:Organism.
Example	detected notDetected
Domain	Occurrence ^c
Range

Organism ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/organismID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:Organism].
Sub Property Of	Identifier ^dp
Domain	Organism ^c
Range	Literal

Organism Interaction ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/organismInteractionID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:OrganismInteraction].
Sub Property Of	Identifier ^dp
Domain	Organism Interaction ^c
Range	Literal

Organism Name ^dp

IRI	`http://rs.tdwg.org/dwc/terms/organismName`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A textual name or label assigned to a dwc:Organism instance.
Example	Boab Prison Tree Huberta J pod
Domain	Organism ^c
Range	Literal

Organism Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/organismRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about the dwc:Organism instance.
Example	One of a litter of six
Domain	Organism ^c
Range	Literal

Organism Scope ^dp

IRI	`http://rs.tdwg.org/dwc/terms/organismScope`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. To describe the kind of dwc:Organism using a URI object in RDF, use rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type) instead. A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Example	clone colony multicellular organism pack virus
Domain	Organism ^c
Range	Literal

Owner Institution Code ^dp

IRI	`http://rs.tdwg.org/dwc/terms/ownerInstitutionCode`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A name (or acronym) in use by an institution having ownership of a dwc:MaterialEntity.
Example	APN InBio NPS
Domain	Material Entity ^c
Range	Literal

Parent Event ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/parentEventID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Use a globally unique identifier for a dwc:Event or an identifier for a dwc:Event that is specific to the data set. An identifier for the broader dwc:Event that groups this and potentially other dwc:Events.
Example	A1
Sub Property Of	Identifier ^dp
Domain	Event ^c
Range	Literal

Parent Reference ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/parentReferenceID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a gloally unique identifier. An identifier for a dcterms:BibliographicResource that this dcterms:BibliographicResource is a part of.
Sub Property Of	Identifier ^dp
Domain	Bibliographic Resource ^c
Range	Literal

Pathway ^dp

IRI	`http://rs.tdwg.org/dwc/terms/pathway`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The process by which a dwc:Organism came to be in a given place at a given time.
Example	corridor otherEscape releasedForUse transportContaminant transportStowaway unaided
Domain	Occurrence ^c
Range

Point Radius Spatial Fit ^dp

IRI	`http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853). The ratio of the area of the point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of the true (original, or most specific) spatial representation of the dcterms:Location. Legal values are `0`, greater than or equal to `1`, or undefined. A value of `1` is an exact match or 100% overlap. A value of `0` should be used if the given point-radius does not completely contain the original representation. The dwc:pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the dwc:pointRadiusSpatialFit is `1`.
Example	0 1 1.5708
Domain	Location ^c
Range	xsd:decimal

Preferred Agent Name ^dp

IRI	`http://rs.tdwg.org/dwc/terms/preferredAgentName`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A name of a [dcterms:Agent] preferred in searches and results.
Sub Property Of	Title ^dp
Domain	Agent ^c
Range	Literal

Preferred Event Name ^dp

IRI	`http://rs.tdwg.org/dwc/terms/preferredEventName`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The name of a [dwc:Event] preferred in searches and results.
Sub Property Of	Title ^dp
Domain	Event ^c
Range	Literal

Preparations ^dp

IRI	`http://rs.tdwg.org/dwc/terms/preparations`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity.
Example	DNA extract cast fossil photograph skin \| skull \| skeleton whole animal (EtOH) \| tissue (EDTA)
Domain	Material Entity ^c
Range	Literal

Project ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/projectID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event.
Example	https://arvenetternansen.com/ https://doi.org/10.26259/3b15eca7 https://doi.org/10.3030/101180559 OC202405 RCN276730 RCN276730 \| Artsproject_7-24
Domain	Provenance ^c
Range	xsd:string ^c or xsd:anyURI ^c

Project Title ^dp

IRI	`http://rs.tdwg.org/dwc/terms/projectTitle`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. Recommended best practice is to separate the values in a list with space vertical bar space (`\|`). A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event.
Example	Arctic Deep Scalidophora i Noreg The Nansen Legacy Underwater Oases of the Mar del Plata Canyon: Talud Continental IV
Domain	Provenance ^c
Range	langString

Protocol Description ^dp

IRI	`http://rs.tdwg.org/dwc/terms/protocolDescription`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A detailed description of a dwc:Protocol.
Domain	Protocol ^c
Range	langString

Protocol ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/protocolID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a dwc:Protocol.
Sub Property Of	Identifier ^dp
Domain	Protocol ^c
Range	xsd:string

Protocol ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/protocolName`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. A name of a dwc:Protocol.
Example	UV light trap ad hoc observation bottom trawl point count
Sub Property Of	Title ^dp
Domain	Protocol ^c
Range	langString

Protocol Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/protocolRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about a dwc:Protocol.
Domain	Protocol ^c
Range	langString

Protocol Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/protocolType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. A category that best matches the nature of a dwc:Protocol.
Example	chronometric age chronometric age conversion georeference measurement sampling effort
Domain	Protocol ^c
Range	xsd:string

Read Count ^dp

IRI	`http://rs.tdwg.org/dwc/terms/readCount`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A number of reads for a [dwc:NucleotideSequence] in a [dwc:NucleotideAnalysis].
Domain	Nucleotide Analysis ^c
Range	xsd:integer

Reference ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/referenceID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a gloally unique identifier. An identifier for a dcterms:BibliographicResource.
Sub Property Of	Identifier ^dp
Domain	Bibliographic Resource ^c
Range	Literal

Reference Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/referenceType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. A category that best matches the nature of a [dcterms:BibliographicResource].
Domain	Bibliographic Resource ^c
Range	Literal

Relationship Established Date ^dp

IRI	`http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. A date on which a [dwc:ResourceRelationship] was established.
Example	1809-02-12 1900/1909 1906-06 1963-04-08T14:07-06:00 1971 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z 2007-11-13/15 2009-02-20T08:40Z 2018-08-29T15:19
Domain	Resource Relationship ^c
Range	Literal

Relationship Remarks ^dp

IRI	`http://rs.tdwg.org/dwc/terms/relationshipRemarks`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Comments or notes about the relationship between the two resources.
Example	mother and offspring collected from the same nest pollinator captured in the act
Domain	Resource Relationship ^c
Range	Literal

Reproductive Condition ^dp

IRI	`http://rs.tdwg.org/dwc/terms/reproductiveCondition`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The reproductive condition of the biological individual(s) represented in the dwc:Occurrence.
Example	fruit-bearing in bloom non-reproductive pregnant
Domain	Occurrence Assertion ^c or Material Entity Assertion ^c
Range	xsd:string

Resource ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/resourceID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An identifier for the resource that is the subject of the relationship.
Sub Property Of	Identifier ^dp
Domain	Resource Relationship ^c
Range	xsd:string

Resource Relationship ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/resourceRelationshipID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	An identifier for an instance of relationship between one resource (the subject) and another (dwc:relatedResource, the object).
Sub Property Of	Identifier ^dp
Domain	Resource Relationship ^c
Range	xsd:string

Sampling Effort ^dp

IRI	`http://rs.tdwg.org/dwc/terms/samplingEffort`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The amount of effort expended during a dwc:Event.
Example	10 km by foot 10 observer-hours 30 km by car 40 trap-nights
Domain	Event ^c
Range	xsd:string

Sampling Protocol ^dp

IRI	`http://rs.tdwg.org/dwc/terms/samplingProtocol`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space (`\|`). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The names of, references to, or descriptions of the methods or protocols used during a dwc:Event.
Example	Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x Takats et al. 2001. Guidelines for Nocturnal Owl Monitoring in North America. Beaverhill Bird Observatory and Bird Studies Canada, Edmonton, Alberta. 32 pp., http://www.bsc-eoc.org/download/Owl.pdf UV light trap ad hoc observation \| point count bottom trawl mist net
Domain	Event ^c
Range	xsd:string

Scientific Name ^dp

IRI	`http://rs.tdwg.org/dwc/terms/scientificName`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Schenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign × (Unicode U+00D7, HTML ×) to identify a hybrid, not x or X, if possible. The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. This term should not contain identification qualifications, which should instead be supplied in the dwc:identificationQualifier term.
Example	Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf. Ambystoma tigrinum diaboli Coleoptera Ctenomys sociabilis Manis Mentha × smithiana R. A. Graham Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell Roptrocerus typographi (Györfi, 1952) Vespertilionidae ×Agropogon littoralis (Sm.) C. E. Hubb.
Domain	Material Entity ^c or Occurrence ^c or Identification ^c
Range	xsd:string

Sequence ^dp

IRI	`http://rs.tdwg.org/dwc/terms/sequence`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A string representing nucleotide base pairs.
Domain	Nucleotide Sequence ^c
Range	xsd:string

Sex ^dp

IRI	`http://rs.tdwg.org/dwc/terms/sex`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The sex of the biological individual(s) represented in the dwc:Occurrence.
Example	female hermaphrodite male
Domain	Occurrence Assertion ^c or Material Entity Assertion ^c
Range	xsd:string

Start Day Of Year ^dp

IRI	`http://rs.tdwg.org/dwc/terms/startDayOfYear`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The earliest integer day of the year on which the dwc:Event occurred (`1` for January 1, `365` for December 31, except in a leap year, in which case it is `366`).
Example	1 365 366
Domain	Event ^c
Range	xsd:integer

First Order Division ^dp

IRI	`http://rs.tdwg.org/dwc/terms/stateProvince`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. The name of the next smaller administrative region than country (state, province, canton, department, region, etc.) in which the dcterms:Location occurs.
Example	Córdoba Minas Gerais Montana
Domain	Location ^c
Range	xsd:string

Survey ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/surveyID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [eco:Survey].
Sub Property Of	Identifier ^dp
Domain	Survey ^c
Range	xsd:string

Survey Target ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/surveyTargetID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [eco:SurveyTarget].
Sub Property Of	Identifier ^dp
Domain	Survey Target ^c
Range	xsd:string

Survey Target Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/surveyTargetType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. A scope a [eco:SurveyTarget] describes.
Example	establishmentMeans growthForm habitat lifeStage minimum length sex taxon
Domain	Survey Target ^c
Range	Literal

Survey Target Type Source ^dp

IRI	`http://rs.tdwg.org/dwc/terms/surveyTargetTypeSource`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A reference to a controlled vocabulary in which the definition of a value in [eco:surveyTargetValue] is given.
Sub Property Of	Source (DC) ^dp
Domain	Survey Target ^c
Range	xsd:string

Total Read Count ^dp

IRI	`http://rs.tdwg.org/dwc/terms/totalReadCount`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A total number of reads in a [dwc:NucleotideAnalysis].
Domain	Nucleotide Analysis ^c
Range	xsd:integer

Usage Policy ID ^dp

IRI	`http://rs.tdwg.org/dwc/terms/usagePolicyID`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a globally unique identifier. An identifier for a [dwc:UsagePolicy].
Sub Property Of	Identifier ^dp
Domain	Usage Policy ^c
Range	xsd:string

Verbatim Assertion Type ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimAssertionType`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term is meant to allow the capture of an unaltered original name for a [dwc:assertionType]. This term is meant to be used in addition to [dwc:assertionType], not instead of it. A string representing the type of [dwc:Assertion] as it appeared in the original record.
Example	Fish biomass sampling net mesh size water_temp
Domain	Assertion ^c
Range	Literal

Verbatim Coordinate System ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The coordinate format for the dwc:verbatimLatitude and dwc:verbatimLongitude or the dwc:verbatimCoordinates of the dcterms:Location.
Example	UTM decimal degrees degrees decimal minutes degrees minutes seconds
Domain	Location ^c
Range	xsd:string

Verbatim Coordinates ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimCoordinates`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The verbatim original spatial coordinates of the dcterms:Location. The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Example	17T 630000 4833400 41 05 54S 121 05 34W
Domain	Location ^c
Range	xsd:string

Verbatim Depth ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimDepth`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The original description of the depth below the local surface.
Example	100-200 m
Domain	Location ^c
Range	xsd:string

Verbatim Elevation ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimElevation`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The original description of the elevation (altitude, usually above sea level) of the dcterms:Location.
Example	100-200 m
Domain	Location ^c
Range	xsd:string

Verbatim EventDate ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimEventDate`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The verbatim original representation of the date and time information for a dwc:Event.
Example	17IV1934 1999-03-XX Marzo 2002 spring 1910
Domain	Event ^c
Range	xsd:string

Verbatim Identification ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimIdentification`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	This term is meant to allow the capture of an unaltered original identification/determination, including identification qualifiers, hybrid formulas, uncertainties, etc. This term is meant to be used in addition to dwc:scientificName (and dwc:identificationQualifier etc.), not instead of it. A string representing the taxonomic identification as it appeared in the original record.
Example	Aconitum pilipes × A. variegatum Anser anser × Branta canadensis Lepomis auritus x cyanellus Ministrymon sp. nov. 1 Pachyporidae? Peromyscus sp. Potentilla × pantotricha Soják
Domain	Identification ^c
Range	xsd:string

Verbatim Label ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimLabel`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:occurrenceRemarks.
Domain	Material Entity ^c
Range	xsd:string

Verbatim Latitude ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimLatitude`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The verbatim original latitude of the dcterms:Location. The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Example	41 05 54.03S
Domain	Location ^c
Range	xsd:string

Verbatim Locality ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimLocality`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The original textual description of the place.
Example	25 km NNE Bariloche por R. Nac. 237
Domain	Location ^c
Range	xsd:string

Verbatim Longitude ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimLongitude`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The verbatim original longitude of the dcterms:Location. The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Example	121d 10' 34" W
Domain	Location ^c
Range	xsd:string

Verbatim SRS ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verbatimSRS`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Example	Campo Inchauspe Clarke 1866 EPSG:4326 European 1950 NAD27 WGS84 not recorded
Domain	Location ^c
Range	xsd:string

Vernacular Name ^dp

IRI	`http://rs.tdwg.org/dwc/terms/vernacularName`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	A common or vernacular name.
Example	Agate American Eagle Amethyst Andean Condor Condor Andino Gänsegeier Smoky Quartz Tiger's Eye death cap rainbow trout
Domain	Occurrence ^c or Identification ^c or Material Entity ^c
Range	xsd:string

Vertical Datum ^dp

IRI	`http://rs.tdwg.org/dwc/terms/verticalDatum`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. The vertical datum used as the reference upon which the values in the elevation terms are based.
Example	EGM2008 EGM84 EGM96 EPSG:7030 PGM2000A PGM2004 PGM2006 PGM2007 not recorded
Domain	Location ^c
Range	xsd:string

Vitality ^dp

IRI	`http://rs.tdwg.org/dwc/terms/vitality`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary. Intended to be used with records having a dwc:basisOfRecord of `PreservedSpecimen`, `MaterialEntity`,`MaterialSample`, or `HumanObservation`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Example	alive dead mixedLot notAssessed uncertain
Domain	Occurrence Assertion ^c or Material Entity Assertion ^c
Range	xsd:string

Water Body ^dp

IRI	`http://rs.tdwg.org/dwc/terms/waterBody`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. The name of the water body in which the dcterms:Location occurs.
Example	Baltic Sea Hudson River Indian Ocean Lago Nahuel Huapi
Domain	Location ^c
Range	Literal

Year ^dp

IRI	`http://rs.tdwg.org/dwc/terms/year`
Is Defined By	http://rs.tdwg.org/dwc/terms/
Description	The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar.
Example	1160 2008
Domain	Event ^c
Range	xsd:integer

Include Or Exclude ^dp

IRI	`http://rs.tdwg.org/eco/terms/includeOrExclude`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	Combinations of dwc:SurveyTarget records of inclusions and exclusions can define complex scopes such as all flying adult Aves except Passeriformes. Recommended best practice is to use a controlled vocabulary consisting of `include` and `exclude` only. Whether the combination of dwc:surveyTargetType and dwc:surveyTargetValue is included or excluded in a dwc:SurveyTarget.
Example	exclude include
Domain	Survey Target ^c
Range

Is Survey Target Fully Reported ^dp

IRI	`http://rs.tdwg.org/eco/terms/isSurveyTargetFullyReported`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	If true (the survey target is fully reported - nothing was left unreported), then this enables inference of absence of detection for everything in that dwc:SurveyTarget that is included but that does not appear in the counts (absent counts signify absence of detection). A declaration of whether the counts for an instance of the dwc:SurveyTarget report everything that matches the declared dwc:SurveyTarget.
Example	false true
Domain	Survey Target ^c
Range	xsd:boolean

Protocol References ^dp

IRI	`http://rs.tdwg.org/eco/terms/protocolReferences`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	Recommended best practice is to separate multiple values in a list with space vertical bar space (`\|`). A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
Example	Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x
Domain	Protocol ^c
Range	xsd:string

Site Count ^dp

IRI	`http://rs.tdwg.org/eco/terms/siteCount`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Total number of sites surveyed during a [dwc:Event].
Example	1 15
Domain	Survey ^c
Range	xsd:integer

Site Nesting Description ^dp

IRI	`http://rs.tdwg.org/eco/terms/siteNestingDescription`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Textual description of a hierarchical sampling design.
Example	5 sampling sites of 3-5 plots each
Domain	Survey ^c
Range	Literal

Verbatim Site Description ^dp

IRI	`http://rs.tdwg.org/eco/terms/verbatimSiteDescriptions`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space (`\|`). Original textual description of site(s).
Example	Wet flatwoods \| Wet depression surrounded by mesic longleaf pine flatwoods \| Ground cover of thick Andropogon spp., Sporobolus floridanus, Vaccinium spp., Rhynchospora spp., Centella erecta, Panicum rigidulum
Domain	Survey ^c
Range	Literal

Verbatim Site Names ^dp

IRI	`http://rs.tdwg.org/eco/terms/verbatimSiteNames`
Is Defined By	http://rs.tdwg.org/eco/terms/
Description	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space (`\|`). A list (concatenated and separated) of original site names.
Example	East Coastal Fringe \| St. Marks Wildlife Management Area S1 \| S2 \| C1 \| C2 \| R14 \| R22 \| W1
Domain	Survey ^c
Range	Literal

Aggregate Form ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/aggregateForm`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Recommended best practice is to use a controlled vocabulary. Observable crystal shapes of an assemblage of minerals.
Example	botryoidal oolithic radial
Domain	Material Entity Assertion ^c
Range	Literal

Alteration Description ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/alterationDescription`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	A description of any observed changes in the composition of a mineral brought about by physical or chemical processes related to changes in the physical or chemical environment. Observable crystal shapes of an assemblage of minerals.
Example	Dolomitization Fenetization Rodingitization
Domain	Material Entity Assertion ^c
Range	Literal

Associated Minerals ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/associatedMinerals`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Observable crystal shapes of an assemblage of minerals.
Example	baryte calcite dolomite
Domain	Material Entity Assertion ^c
Range	Literal

Cleavage ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/cleavage`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Types of breakages along a plane of weakness, especially those parallel to crystal faces.
Example	Extraordinary well developped rectangular cleavage
Domain	Material Entity Assertion ^c
Range	Literal

Color ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/color`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Here, color is caused by the absorption, or lack of absorption of different wavelengths of natural light by a particular mineral. The intrinsic color of a mineral under natural light.
Example	Blue green iridescent red
Domain	Material Entity Assertion ^c
Range	Literal

Crystal Form ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/crystalForm`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Recommended best practice is to use a controlled vocabulary. Geometric shape of a crystal.
Example	cube ditrigonal pyramid scalenohedron
Domain	Material Entity Assertion ^c
Range	Literal

Crystal Habit ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/crystalHabit`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Recommended best practice is to use a controlled vocabulary. For a given type of crystal, the habit may vary from locality to locality depending on environment of growth. A general term for describing the outward appearance of a mineral.
Example	dogtooth fibrous isometric nailhead tabular
Domain	Material Entity Assertion ^c
Range	Literal

Exsolution Texture ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/exsolutionTexture`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	A brief description of textures formed by exsolution.
Example	Antiperthite exsolution Clinopyroxene lamellae around the (100) plane of the orthopyroxene Ilemenite lamellae in olivine
Domain	Material Entity Assertion ^c
Range	Literal

Geo Classification Code ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/geoClassificationCode`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Classification codes are specific to a classification system and conform to a xkos:notationPattern. Alphanumeric pattern that adheres to a defined encoding scheme that identifies a particular term in a classification scheme.
Example	71.02.02a.01 9.AD.25
Domain	Material Entity ^c
Range	xsd:string

Geo Name ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/geoName`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	A human-readable lexical label assigned to a mineral includes both informal (e.g., variety, synonym) and formal (classification) forms.
Example	Almandine Fluorite Garnet Group Plagioclase (Series)
Domain	Material Entity ^c
Range	xsd:string

Inclusions ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/inclusions`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Short description of any inclusions present within a mineral that includes the phase and physical characteristics.
Example	Fluid inclusions (liquid bubble and single crystal) in quartz Needles of tourmaline in quartz (blue quartz) Star-shaped rutile needles in quartz
Domain	Material Entity Assertion ^c
Range	Literal

Luminescence ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/luminescence`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Includes all types of luminescence including fluorescence (all wavelengths) and phosphorescence. Recommended best practice is to use nomenclature in part based on the source of energy, or the trigger for luminescence. The type and nature of light emitted from the mineral upon receiving energy from an external source.
Example	Green fluorescence Pink under short wave UV light
Domain	Material Entity Assertion ^c
Range	Literal

Luster ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/luster`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Recommended best practice is to use a controlled vocabulary. The reflection of light from the surface of a mineral, described by its quality and intensity.
Example	Glassy Metallic Waxy
Domain	Material Entity Assertion ^c
Range	Literal

Maximum Crystal Dimension In Millimiters ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/maxCrystalDimensionInMillimiters`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Maximum axial dimension of largest crystal measured in millimeters.
Example	30
Domain	Material Entity Assertion ^c
Range	xsd:decimal

Maximum Specimen Dimension In Millimeters ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/maxSpecimenDimensionInMillimeters`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Maximum axial dimension of specimen measured in millimeters.
Example	100
Domain	Material Entity Assertion ^c
Range	xsd:decimal

Measured Mass In Grams ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/measuredMassInGrams`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Mass of specimen measured in grams.
Example	4994
Domain	Material Entity Assertion ^c
Range	xsd:decimal

Mineral Description ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/mineralDescription`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	The scope of this term is strictly to a mineral within the context of the specimen. Specimen level descriptions belong in the related term minext:specimenDescription. Sibling concept to http://rs.tdwg.org/dwc/terms/occurrenceRemarks. Comments or notes about the mineral instance, especially those that distinguish the mineral from similar items in a collection.
Example	Doubly terminated quartz crystals Epitaxial growth on kyanite Lengenbachite on sugar-stained dolomite Pink fluorite on quartz
Domain	Material Entity Assertion ^c
Range	Literal

Specimen Description ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/specimenDescription`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	See broader concept http://rs.tdwg.org/dwc/terms/occurrenceRemarks for additional usage notes. Comments or notes about the specimen (physical object) especially those that distinguish the specimen from similar materials in a collection.
Example	Extraordinary composition Historically valuable Showpiece Two generations of quartz
Domain	Material Entity Assertion ^c
Range	Literal

Twinning Law ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/twinningLaw`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	Short description of any physically discernable twining.
Example	Brazil twinning/Brazil Law Dauphiné twinning/Dauphiné Law Japan twinning/Japan Law
Domain	Material Entity Assertion ^c
Range	Literal

Verbatim Mass ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/verbatimMass`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	The original reported verbatim mass includes original units of measurement.
Example	105.07 g 11.01 Lbs 2.45 kg
Domain	Material Entity Assertion ^c
Range	Literal

Verbatim Size ^dp

IRI	`http://rs.tdwg.org/mineralogy/terms/verbatimSize`
Is Defined By	http://rs.tdwg.org/mineralogy/terms/
Description	The verbatim size of a specimen as originally described in primary source material.
Example	10 cm x 5 cm X 5 cm largest diameter 16 cm width 3 inches
Domain	Material Entity Assertion ^c
Range	Literal

Amount Or Size Of Sample Collected ^dp

IRI	`https://w3id.org/mixs/0000001`
Is Defined By	https://w3id.org/mixs/
Description	The total amount or size (volume (ml), mass (g) or aread (m2)) of sample collected.
Example	5 liter
Domain	Molecular Protocol ^c
Range	xsd:string

Sample Collection Device ^dp

IRI	`https://w3id.org/mixs/0000002`
Is Defined By	https://w3id.org/mixs/
Description	The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device ([http://purl.obolibrary.org/obo/ENVO]). This field also accepts terms listed under specimen collection device ([http://purl.obolibrary.org/obo/GENEPIO_0002094]).
Domain	Molecular Protocol ^c
Range	xsd:string

Isolation And Growth Condition ^dp

IRI	`https://w3id.org/mixs/0000003`
Is Defined By	https://w3id.org/mixs/
Description	Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material.
Example	doi:10.1016/j.syapm.2018.01.009
Domain	Molecular Protocol ^c
Range	xsd:string

Contamination Screening Input ^dp

IRI	`https://w3id.org/mixs/0000005`
Is Defined By	https://w3id.org/mixs/
Description	This property only takes a finite set of possible literal values. For more details, see: [https://genomicsstandardsconsortium.github.io/mixs/ContamScreenInputEnum/]. The type of sequence data used as input.
Example	contigs
Domain	Molecular Protocol ^c
Range

WGA Amplification Kit ^dp

IRI	`https://w3id.org/mixs/0000006`
Is Defined By	https://w3id.org/mixs/
Description	Kit used to amplify genomic DNA in preparation for sequencing.
Example	qiagen repli-g
Domain	Molecular Protocol ^c
Range	xsd:string

Experimental Factor ^dp

IRI	`https://w3id.org/mixs/0000008`
Is Defined By	https://w3id.org/mixs/
Description	For a browser of [efo:] (v 2.95) terms, please see [http://purl.bioontology.org/ontology/EFO]; for a browser of [obi:] (v 2018-02-12) terms please see [http://purl.bioontology/ontology/OBI]. Experimental factors are essentially the the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology ([efo:]) and/or Ontology for Biomedical Investigations ([obi:]).
Domain	Molecular Protocol ^c
Range	xsd:string

Broad-scale Environmental Context ^dp

IRI	`https://w3id.org/mixs/0000012`
Is Defined By	https://w3id.org/mixs/
Description	In this field, report which major environmental system your sample or specimen came from. The systems identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. were you in the desert or a rainforest?). We recommend using subclasses of ENVO’s biome class: [http://purl.obolibrary.org/obo/ENVO_00000428]. Format (one term): termLabel [termID], Format (multiple terms): termLabel [termID]\|termLabel [termID]\|termLabel [termID]. Example: Annotating a water sample from the photic zone in middle of the Atlantic Ocean, consider: oceanic epipelagic zone biome [ENVO:01000033]. Example: Annotating a sample from the Amazon rainforest consider: tropical moist broadleaf forest biome [ENVO:01000228]. If needed, request new terms on the ENVO tracker, identified here: [http://www.obofoundry.org/ontology/envo.html].
Example	oceanic epipelagic zone biome [ENVO:01000033] tropical moist broadleaf forest biome [ENVO:01000228]
Domain	Molecular Protocol ^c
Range	xsd:string

Local Environmental Context ^dp

IRI	`https://w3id.org/mixs/0000013`
Is Defined By	https://w3id.org/mixs/
Description	In this field, report the entity or entities which are in your sample or specimen's local vicinity and which you believe have significant causal influences on your sample or specimen. Please use terms that are present in [envo:] and which are of smaller spatial grain than your entry for [mixs:env_broad_scale]. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]\|termLabel [termID]\|termLabel [termID]. Example: Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]\|herb and fern layer [ENVO:01000337]\|litter layer [ENVO:01000338]\|understory [01000335]\|shrub layer [ENVO:01000336]. If needed, request new terms on the ENVO tracker, identified here: [http://www.obofoundry.org/ontology/envo.html].
Example	canopy [ENVO:00000047]\|herb and fern layer [ENVO:01000337]\|litter layer [ENVO:01000338]\|understory [01000335]\|shrub layer [ENVO:01000336]
Domain	Molecular Protocol ^c
Range	xsd:string

Environmental Medium ^dp

IRI	`https://w3id.org/mixs/0000014`
Is Defined By	https://w3id.org/mixs/
Description	In this field, report which environmental material or materials (pipe separated) immediately surrounded your sample or specimen prior to sampling, using one or more subclasses of ENVO’s environmental material class: [http://purl.obolibrary.org/obo/ENVO_00010483]. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]\|termLabel [termID]\|termLabel [termID]. Example: Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]\|air ENVO_00002005. If needed, request new terms on the ENVO tracker, identified here: [http://www.obofoundry.org/ontology/envo.html].
Example	ocean water [ENVO:00002151] pond water [ENVO:00002228]\|air ENVO_00002005
Domain	Molecular Protocol ^c
Range	xsd:string

Relation To Oxygen ^dp

IRI	`https://w3id.org/mixs/0000015`
Is Defined By	https://w3id.org/mixs/
Description	This property only takes a finite set of possible literal values. For more details, see: [https://genomicsstandardsconsortium.github.io/mixs/RelToOxygenEnum/] Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments.
Example	aerobe
Domain	Molecular Protocol ^c
Range

Sample Material Processing ^dp

IRI	`https://w3id.org/mixs/0000016`
Is Defined By	https://w3id.org/mixs/
Description	A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
Example	filtering of seawater, storing samples in ethanol
Domain	Molecular Protocol ^c
Range	xsd:string

Size Fraction Selected ^dp

IRI	`https://w3id.org/mixs/0000017`
Is Defined By	https://w3id.org/mixs/
Description	Filtering pore size used in sample preparation.
Example	0-0.22 micrometer
Domain	Molecular Protocol ^c
Range	xsd:string

Subspecific Genetic Lineage ^dp

IRI	`https://w3id.org/mixs/0000020`
Is Defined By	https://w3id.org/mixs/
Description	This should provide further information about the genetic distinctness of the sequenced organism by recording additional information e.g. serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. It can also contain alternative taxonomic information. It should contain both the lineage name, and the lineage rank, i.e. `biovar:abc123`.
Example	serovar:Newport
Domain	Molecular Protocol ^c
Range	xsd:string

Ploidy ^dp

IRI	`https://w3id.org/mixs/0000021`
Is Defined By	https://w3id.org/mixs/
Description	The ploidy level of the genome (e.g. `allopolyploid`, `haploid`, `diploid`, `triploid`, `tetraploid`). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy ([pato:001374]) of Phenotypic Quality Ontology ([pato:]), and for a browser of PATO (v 2018-03-27) please refer to [http://purl.bioontology.org/ontology/PATO].
Example	allopolyploidy [PATO:0001379]
Domain	Molecular Protocol ^c
Range	xsd:string

Number Of Replicons ^dp

IRI	`https://w3id.org/mixs/0000022`
Is Defined By	https://w3id.org/mixs/
Description	Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote.
Example	2
Domain	Molecular Protocol ^c
Range	xsd:integer

Extrachromosomal Elements ^dp

IRI	`https://w3id.org/mixs/0000023`
Is Defined By	https://w3id.org/mixs/
Description	Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids).
Example	5
Domain	Molecular Protocol ^c
Range	xsd:integer

Estimated size ^dp

IRI	`https://w3id.org/mixs/0000024`
Is Defined By	https://w3id.org/mixs/
Description	The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
Example	300000 bp
Domain	Molecular Protocol ^c
Range	xsd:string

Project Name ^dp

IRI	`https://w3id.org/mixs/0000092`
Is Defined By	https://w3id.org/mixs/
Description	Name of the project within which the sequencing was organized.
Domain	Molecular Protocol ^c
Range	Literal

Sample Name ^dp

IRI	`https://w3id.org/mixs/0001107`
Is Defined By	https://w3id.org/mixs/
Description	Sample Name is a name that you choose for the sample. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. Every Sample Name from a single Submitter must be unique.
Domain	Molecular Protocol ^c
Range	Literal

Taxonomy ID Of DNA Sample ^dp

IRI	`https://w3id.org/mixs/0001320`
Is Defined By	https://w3id.org/mixs/
Description	NCBI taxon ID of the sample. May be a single taxon or mixed taxa sample. Use "synthetic metagenome" for mock community positive controls, or "blank sample" for negative controls.
Domain	Molecular Protocol ^c
Range	Literal

Negative Control Type ^dp

IRI	`https://w3id.org/mixs/0001321`
Is Defined By	https://w3id.org/mixs/
Description	The substance or equipment used as a negative control in an investigation.
Domain	Molecular Protocol ^c
Range	Literal

Positive Control Type ^dp

IRI	`https://w3id.org/mixs/0001322`
Is Defined By	https://w3id.org/mixs/
Description	The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
Domain	Molecular Protocol ^c
Range	Literal

, , , , , , , , , , , , , ,

Namespaces

ns1: http://bioboum.ca/
owl: http://www.w3.org/2002/07/owl#
rdf: http://www.w3.org/1999/02/22-rdf-syntax-ns#
rdfs: http://www.w3.org/2000/01/rdf-schema#
xsd: http://www.w3.org/2001/XMLSchema#

Legend

^c	Classes
^op	Object Properties
^dp	Datatype Properties

Darwin Core OWL

Metadata

Classes

Permit Status Vocabulary c

Permit Type Vocabulary c

Agent c

Bibliographic Resource c

Location c

Document (BIBO) c

Document Status c

Media c

Chronometric Age c

Assertion c

Bibliographic Document c

Degree Of Establishment c

Establishment Means c

Event c

Geological Context c

Identification c

Material Entity c

Material Entity Assertion c

Molecular Protocol c

Nucleotide Analysis c

Nucleotide Sequence c

Occurrence c

Occurrence Assertion c

Organism c

Organism Assertion c

Organism Interaction c

Organism Interaction Agent Role c

Organism Relationship c

Permit c

Protocol c

Provenance c

Resource Relationship c

Subject Orientation c

Subject Part c

Taxon c

Type Designation Type c

Usage Policy c

Survey c

Survey Target c

Concept c

Concept Scheme c

Object Properties

Contributor (DCTERMS) op

Creator (DCTERMS) op

Publisher (DCTERMS) op

Rights (DCTERMS) op

Rights Holder op

Spatial Coverage op

Type op

Located At op

Occurrence Of (DSW) op

Status op

Commenter op

Metadata Creator op

Metadata Provider op

Reviewer op

Assertion Type (IRI) op

Assertion Value (IRI) op

Behavior (IRI) op

Caste (IRI) op

Data Generalizations (IRI) op

Degree Of Establishment (IRI) op

Discipline (IRI) op

Disposition (IRI) op

Earliest Geochronological Era op

Establishment Means (IRI) op

Event Type (IRI) op

Field Notes (IRI) op

Field Number (IRI) op

Footprint WKT (IRI) op

Geodetic Datum (IRI) op

Georeference Protocol (IRI) op

Georeference Sources (IRI) op

Georeference Verification Status (IRI) op

Georeferenced By (IRI) op

Habitat (IRI) op

Identified By (IRI) op

Permit Status Vocabulary ^c

Permit Type Vocabulary ^c

Agent ^c

Bibliographic Resource ^c

Location ^c

Document (BIBO) ^c

Document Status ^c

Media ^c

Chronometric Age ^c

Assertion ^c

Bibliographic Document ^c

Degree Of Establishment ^c

Establishment Means ^c

Event ^c

Geological Context ^c

Identification ^c

Material Entity ^c

Material Entity Assertion ^c

Molecular Protocol ^c

Nucleotide Analysis ^c

Nucleotide Sequence ^c

Occurrence ^c

Occurrence Assertion ^c

Organism ^c

Organism Assertion ^c

Organism Interaction ^c

Organism Interaction Agent Role ^c

Organism Relationship ^c

Permit ^c

Protocol ^c

Provenance ^c

Resource Relationship ^c

Subject Orientation ^c

Subject Part ^c

Taxon ^c

Type Designation Type ^c

Usage Policy ^c

Survey ^c

Survey Target ^c

Concept ^c

Concept Scheme ^c

Contributor (DCTERMS) ^op

Creator (DCTERMS) ^op

Publisher (DCTERMS) ^op

Rights (DCTERMS) ^op

Rights Holder ^op

Spatial Coverage ^op

Type ^op

Located At ^op

Occurrence Of (DSW) ^op

Status ^op

Commenter ^op

Metadata Creator ^op

Metadata Provider ^op

Reviewer ^op

Assertion Type (IRI) ^op

Assertion Value (IRI) ^op

Behavior (IRI) ^op

Caste (IRI) ^op

Data Generalizations (IRI) ^op

Degree Of Establishment (IRI) ^op

Discipline (IRI) ^op

Disposition (IRI) ^op

Earliest Geochronological Era ^op

Establishment Means (IRI) ^op

Event Type (IRI) ^op

Field Notes (IRI) ^op

Field Number (IRI) ^op

Footprint WKT (IRI) ^op

Geodetic Datum (IRI) ^op

Georeference Protocol (IRI) ^op

Georeference Sources (IRI) ^op

Georeference Verification Status (IRI) ^op

Georeferenced By (IRI) ^op

Habitat (IRI) ^op

Identified By (IRI) ^op

Location According To (IRI) ^op

Occurrence Status (IRI) ^op

Pathway (IRI) ^op

Recorded By (IRI) ^op